May 24, 2023
Generation of CRISPR constructs
- 1Laboratory of Michael Lazarou, Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria, Australia
- Thanh Ngoc Nguyen: [email protected]
- ASAP workspace
Protocol Citation: Thanh Ngoc Nguyen 2023. Generation of CRISPR constructs. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlkkzo6l5r/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 03, 2022
Last Modified: May 31, 2024
Protocol Integer ID: 68125
Keywords: CRISPR, Sequencing analysis, gRNA, ASAPCRN, generation of crispr, crispr, procedure of generation, generation, procedure
Funders Acknowledgements:
Aligning Science Across Parkinson’s (ASAP)
Grant ID: ASAP-000350
Abstract
This protocol details the procedure of generation of CRISPR constructs.
Attachments
iqsybr7hf.docx
19KB
Materials
Buffers and reagents:
- pSpCas9(BB)-2A-GFP (PX458)addgeneCatalog #48138
- Qiagen miniprep kit (Qiagen, #28104)
- BbsINEBCatalog #3539
- Alkaline Phosphatase, Calf Intestinal (CIP)New England BiolabsCatalog #M0290
- NEBuilder HiFi DNA Assembly Master Mix - 10 rxnsNew England BiolabsCatalog #E2621S
- NEB® 5-alpha Competent E. coli (NEB #C2987)
- Growth broth: a mixture of LB broth and Super broth with 1:1 ratio
Procedure
17h 5m
Designing gRNAs using https://chopchop.cbu.uib.no.
Note
I prefer this website because it also gives you the primer sequences for sequencing analysis.
“Target”: Put in the gene name/“In”: choose the species.
Note
For human cell lines, I choose “Homo sapiens (hg38/GRCh38)/“Using”: for knockout I choose “CRISPR/Cas9”/“For”: I choose “knock-out”.
Do not change anything in “General” tab.
Note
Make sure in “target specific region of gene”, “Coding region” is chosen.
In the “Cas9” tab, make sure you choose “No requirements” for “5’ requirements for sgRNA” and tick “I intend to replace the leading nucleotides with “GG”” (3 options of the “Sef-complementarity (Thyme et al.)” should be ticked).
In “Primers” tab, I choose product size from 200 to 500 and minimum distance from primer to target site at least 100.
Click “Find target sites”.
Choose the top-ranking gRNA sequences that target the earliest exon possible.
Note
Make sure that the targeted exon is shared between the isoforms (check on https://asia.ensembl.org/index.html).
If the protein is too big or it’s not possible to choose a target common in all the isoforms, you can use two different gRNAs.
Click on the chosen target sequence, another window with all the information related to this gRNA sequence will appear.
Note
- In this window, you can also find a table with primer pairs to amplify the targeted region for sequencing analysis.
- You can copy and paste these sequences into a word document and order them.
- If no primers appear, go back to “Primers” tab from step one and change the parameters.
Copy the target sequence without the PAM into the highlighted region of the below sequence:
Note
ATCTTGTGGAAAGGACGAAACACCG Copy the target sequence without the PAM here GTTTTAGAGCTAGAAATAGCAAGTT.
Order the above sequence as a primer for Gibson assembly.
Preparing cut pSpCas9(BB)-2A-GFP:
Cut the vector with BbsI:
- 10 µg of vectors
- 2 µL of BbsI
- 3 µL of NEBuffer™ r1.1
- Add sterile milliQ water to 30 µL
- Incubate for 6-8 hours at 37 °C
After that, add 1 µL of CIP and incubate for no longer than 01:00:00 .
1h
Heat de-activate at 60 °C for 00:05:00 .
5m
Run the reaction on a 0.5 % DNA agarose gel.
Extract the cut vector, determine the concentration, dilute it to 10 ng/µl and aliquot to 1 µL aliquots and store at -20 °C .
Dilute the primer from steps 4 and 5 to the final concentration of 0.8 micromolar (µM) (1/125 dilution of the 100 micromolar (µM) stock). Set up a Gibson assembly reaction as following:
- 1 µL of the diluted primers
- 1 µL of BbsI-linearised pSpCas9(BB)-2A-GFP
- 2 µL of HiFi DNA Assembly Master Mix
- Incubate at 50 °C for 02:00:00 .
2h
Transform 1.8 µL of the mix from step 7 (the rest can be stored at -20 °C as a backup in case the transformation does not result in any colonies) using 10 µL of the NEB® 5-alpha Competent E. coli cells with manufacturer’s instructions.
Note
Note: The cells come in with bigger volume so make sure you make 10 l aliquots upon thawing out.
The next day, pick up a few colonies and set up overnight cultures in growth broth.
Miniprep the cultures to purify plasmids and send them for sequencing using this primer (5’ GCTCACCTCGACCATGGTAAT 3’).
Once sequenced verified, the CRISPR constructs are now ready to be used for transfection.