Jun 15, 2026
Generation of CRISPR/Cas9 ATG2A/ATG2B Knockout Cells
- Elisabeth Holzer1
- 1Laboratory of Sascha Martens, Max Perutz Labs, University of Vienna, Austria
Protocol Citation: Elisabeth Holzer 2026. Generation of CRISPR/Cas9 ATG2A/ATG2B Knockout Cells. protocols.io https://dx.doi.org/10.17504/protocols.io.81wgbw6kngpk/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
-
Created: July 31, 2025
Last Modified: June 15, 2026
Protocol Integer ID: 223857
Keywords: Plasmids, Knockout, Cloning, atg2b knockout cell, generation of crispr, atg2b knockout cells this protocol, cas9 atg2a, crispr, atg2a, description of generation, generation
Funders Acknowledgements:
Aligning Science Across Parkinson’s (ASAP)
Grant ID: ASAP-000350
DOC Fellowship (Austrian Academy of Sciences)
Abstract
This protocol details the description of Generation of CRISPR/Cas9 ATG2A/ATG2B Knockout Cells.
Materials
Vector digestion with BbsI:
- 1 µg pSpCas9(BB)-2A-GFP or pSpCas9(BB)-2A-mCherry
- 1 µL BbsI (NEB, Cat# R0539S)
BbsINew England BiolabsCatalog #R0539S
- 1 µL FastAP (Thermo Fisher, Cat# EF0654)
FastAP Thermosensitive Alkaline PhosphataseThermo ScientificCatalog #EF0654
- 2 µL Buffer G (Thermo Fisher, Cat# BG5)
Buffer G (10X)Thermo FisherCatalog #BG5
- Add sterile MilliQ H₂O to 20 µL total
Oligo phosphorylation and annealing:
- 1 µL Forward oligo (100 µM)
- 1 µL Reverse oligo (100 µM)
- 1 µL 10× T4 ligation buffer (NEB, Cat# B0202S)
T4 DNA Ligase Reaction BufferNew England BiolabsCatalog #B0202S
- 6 µL H₂O
- 1 µL T4 PNK (NEB, Cat# M0201S)
T4 Polynucleotide kinaseNew England BiolabsCatalog #M0201S
Ligation:
- 1 µL diluted oligo duplex
- 5 µL 2× Quick Ligase Buffer (NEB, Cat# B2200SVIAL)
- Add H₂O to 9 µL
- 1 µL Quick Ligase (NEB, Cat# M2200LVIAL)
1 µL Quick LigaseNEBCatalog #M2200LVIAL
- E. coli DH5α (Thermo Fisher, Cat# 18265017)
Subcloning Efficiency™ DH5α Competent CellsThermo FisherCatalog #18265017
- Lipofectamine 3000 (Thermo Fisher, Cat# L3000008)
Lipofectamine™ 3000 Transfection ReagentThermo Fisher ScientificCatalog #L3000008
Antibodies used:
- Anti-ATG2A: Proteintech, Cat# 23226-1-AP
Anti-ATG2AProteintechCatalog #23226-1-AP
- Anti-ATG2B: Proteintech, Cat# 25155-1-AP
Anti-ATG2BProteintechCatalog #25155-1-AP
- Anti-GAPDH: Merck, Cat# G8795-25µL
Anti-GAPDHMerck MilliporeSigma (Sigma-Aldrich)Catalog #G8795
Generation of Plasmids
1h 15m
Design of sgRNAs.
- Candidate single-guide RNAs (sgRNAs) were identified using CRISPick (RRID:SCR_025148; https://portals.broadinstitute.org/gppx/crispick/public), targeting all common splicing variants.
- Reference genome: Human GRCh38
- Mechanism: CRISPRko
- Enzyme: spyoCas9
- On-target scorer: RS3seq-Hsu2013+RS3target
- Selected sgRNA sequences:
o ATG2A KO: ACAGCAGTGGACAACATGTG (Exon 21)
o ATG2B KO: TAGTAGGTTCCAACCAGTGT (Exon 22)
Cloning sgRNAs into Cas9 vectors.
- Ordered short oligonucleotides (forward and reverse) from Microsynth.
- Cloned into:
o pSpCas9(BB)-2A-GFP (RRID:Addgene_48138)
o pSpCas9(BB)-2A-mCherry (RRID:Addgene_197420)
Vector digestion with BbsI.
Set up the following digestion reaction:
- 1 µg pSpCas9(BB)-2A-GFP or pSpCas9(BB)-2A-mCherry
- 1 µL BbsI (NEB, Cat# R0539S)
- 1 µL FastAP (Thermo Fisher, Cat# EF0654)
- 2 µL Buffer G (Thermo Fisher, Cat# BG5)
- Add sterile MilliQ H₂O to 20 µL total
Incubate at 37 °C for 00:30:00 .
30m
Oligo phosphorylation and annealing.
Mix:
- 1 µL Forward oligo (100 micromolar (µM) )
- 1 µL Reverse oligo (100 micromolar (µM) )
- 1 µL 10× T4 ligation buffer (NEB, Cat# B0202S)
- 6 µL H₂O
- 1 µL T4 PNK (NEB, Cat# M0201S)
Annealing protocol (thermocycler):
- 37 °C for 00:30:00
- 95 °C for 00:05:00
- Ramp down to 25 °C at 5 °C/min
35m
Dilute the annealed oligos 1:200 in sterile H₂O.
Ligation.
Set up a 10 µL ligation reaction.
- 50 ng digested plasmid (BbsI-digested)
Note
Freshly purified plasmids yield better results.
- 1 µL diluted oligo duplex
- 5 µL 2× Quick Ligase Buffer (NEB, Cat# B2200SVIAL)
- Add H₂O to 9 µL
- 1 µL Quick Ligase (NEB, Cat# M2200LVIAL)
Incubate for 00:10:00 at Room temperature .
10m
Transformation & Plasmid Preparation.
Transform ligation product into E. coli DH5α (Thermo Fisher, Cat# 18265017).
Grow colonies overnight in selective media.
Miniprep the plasmids the following day.
Verify sgRNA insertion by Sanger sequencing using primer hU6-f (from Microsynth Standard Primer List).
Use only sequence-verified constructs for transfection.
Transfection and Cell Line Generation
10m
Cell Seeding.
One day prior to transfection, seed 700,000 cells per well in a 6-well plate.
Transfection with sgRNA-containing plasmids.
Transfect HAP1 or HeLa cells with Lipofectamine 3000 (Thermo Fisher, Cat# L3000008).
Transfection Mix:
- Mix A:
o 125 µL Opti-MEM
o 5 µL P3000 reagent
o 2000 ng DNA (A) + 2000 ng DNA (B)
- Mix B:
o 125 µL Opti-MEM
o 5 µL Lipofectamine 3000
Combine Mix A and Mix B, incubate 00:10:00 at Room temperature , and add dropwise to the cells.
10m
Cell Sorting.
48 hours post-transfection, sort single GFP- and mCherry-positive cells by FACS into 96-well plates.
Note
Instrument: BD FACSMelody Cell Sorter
Clone Expansion and Validation.
Expand single-cell clones.
Identify knockout clones by Western blot.
Antibodies used:
- Anti-ATG2A: Proteintech, Cat# 23226-1-AP
- Anti-ATG2B: Proteintech, Cat# 25155-1-AP
- Anti-GAPDH: Merck, Cat# G8795-25µL
Genotyping.
Extract genomic DNA from candidate knockout (KO) clones.
Amplify regions surrounding the sgRNA target sites by PCR using the following primers:
o For ATG2A:
- Forward: ATGGTGGAAACTGGAGCTGA
- Reverse: GCAAGCCCATACCTTCACAT
o For ATG2B:
- Forward: GCTCTCTCCTTCCCGTAAAC
- Reverse: ATTTTAACGGCAACAGACAGC
Confirm editing by Sanger sequencing of the PCR products.