Feb 19, 2026

Public workspaceGeneration of cirVDJseq libraries from 3’-barcoded cDNA V.1

DOI
https://dx.doi.org/10.17504/protocols.io.q26g77zx1gwz/v1
Generation of cirVDJseq libraries from 3’-barcoded cDNA
  • Izabela Plumbom1,2,
  • Benedikt Obermayer3,
  • Thomas Conrad1,2
  • 1Max Delbrück Center for Molecular Medicine in the Helmholtz Association, Berlin Germany;
  • 2Berlin Institute of Health (BIH) at Charité - Universitätsmedizin Berlin , Germany;
  • 3Berlin Institute of Health (BIH) at Charité - Universitätsmedizin Berlin, Germany
Izabela.Plumbom
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.q26g77zx1gwz/v1
External link: https://www.biorxiv.org/content/10.1101/2025.09.16.675546v1
Protocol Citation: Izabela Plumbom, Benedikt Obermayer, Thomas Conrad 2026. Generation of cirVDJseq libraries from 3’-barcoded cDNA. protocols.io https://dx.doi.org/10.17504/protocols.io.q26g77zx1gwz/v1
Manuscript citation:
Plumbom I et al. circVDJ-seq for T cell clonotype detection in single-cell and spatial multi-omics. bioRxiv 2025. doi:10.1101/2025.09.16.675546
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 17, 2025
Last Modified: February 19, 2026
Protocol Integer ID: 235255
Keywords: circVDJ-seq, T cell receptor, TCR sequencing, VDJ profiling, immune repertoire, T cell clonality, 3’-barcoded cDNA, single-nucleus RNA-seq, RNA+ATAC multi-omics, spatial transcriptomics, circular DNA library preparation, Gibson assembly, 10x Genomics, human tissue, adaptive immunity, cancer immunology, infectious diseases, COVID-19, 10x genomics vdj library construction, robust recovery of tcrα, generation of cirvdjseq library, cirvdjseq library, efficient tcr vdj profiling, ready tcr library, immune microenvironments across diverse clinical sample, spatial transcriptomics workflow, tapestation high sensitivity dna assay, nucleus nucleus rna, cdna, tcrα, diverse clinical sample, circvdj, clonal repertoire, remaining linear dna, linear dna, immune microenvironment, quality vdj library peak
Abstract
This protocol describes circVDJ-seq, a method for simplified and cost-efficient TCR VDJ profiling from 3’-barcoded cDNA generated in single-cell or single-nucleus nucleus RNA-seq, RNA+ATAC multi-omics, or spatial transcriptomics workflows. 3’-barcoded cDNA is modified with Gibson assembly overhangs, circularized, depleted of remaining linear DNA, and subjected to nested PCR and 10x Genomics VDJ library construction to generate sequencing-ready TCR libraries.
The expected outcome is a discrete, high-quality VDJ library peak on TapeStation High Sensitivity DNA assays with sufficient yield for Illumina sequencing using custom primers. When applied to human tissues, circVDJ-seq enables robust recovery of TCRα/β VDJ sequences and clonal repertoires, allowing characterization of T cell clonality and immune microenvironments across diverse clinical samples.
Attachments
Icon for 2025.09.16.675546v1.full.pdf
2025.09.16.675546v1....
5.9MB
Icon for Plumbom and Obermayer et al. circVDJ-seq_Supplementary_Tables.xlsx
Plumbom and Obermaye...
25KB
Image Attribution
Image reproduced from Plumbom et al., "circVDJ-seq for T cell clonotype detection in single-cell and spatial multi-omics", bioRxiv 2025. doi:10.1101/2025.09.16.675546
Guidelines

  • This protocol is optimized for TCR V(D)J enrichment from 3’-barcoded cDNA derived from single-cell or single-nucleus RNA-seq, RNA+ATAC, or spatial transcriptomics workflows. Using other cDNA types may require re-optimization of input amount and cycle numbers.
  • Whenever possible, start with high-quality 3’-barcoded cDNA that has already passed QC (TapeStation/Fragment Analyzer and Qubit). Degraded or very low-complexity input will reduce clonotype recovery.
  • Maintain accurate AMPure XP/SPRIselect bead ratios (0.8X–0.9X as indicated). Deviations in bead volume critically affect size selection and yield. Mix beads thoroughly before use.
  • Avoid over-drying bead pellets. Over-dried beads are difficult to resuspend and can cause large losses of DNA. Pellets should appear matte but not cracked.
  • Use freshly prepared 80% ethanol for washes. Residual salts or lower ethanol concentration will impair cleanup efficiency.
  • Adjust the number of PCR cycles (especially V(D)J Amplification 1) according to sample type and expected T-cell content. Over-amplification can introduce bias and increase PCR artifacts.
  • Perform QC after each major stage (post-PCR#1, post-circularization, post-V(D)J enrichment, final libraries) using Qubit and TapeStation to monitor yield and fragment size and to identify issues early.
  • For library construction, follow the Chromium Next GEM Single Cell 5’ v2 (Dual Index) V(D)J Library Construction instructions closely, using the custom V(D)J cDNA as input and the custom sequencing primers listed in the protocol.
  • Include appropriate controls where possible (e.g. T-cell–rich reference sample or a previously validated sample) to benchmark clonotype recovery and library performance between runs.
Materials
Chemicals/kits
Chemicals/KitsAdditional DescriptionManufacturer
EthanolCatalog number: 11096.02SERVA Electrophoresis
Elution Buffer (EB)Catalog number: 19086QIAGEN
Agencourt AMPure XPREF: A63881Beckman Coulter GmbH
KAPA HiFi HotStart ReadyMixPCR KitREF: 07958927001KAPA Biosystems
QubitTM dsDNA HS Assay KitQuantitation Range: 0.2-100 ngInvitrogen
High Sensitivity D1000 ScreenTape KitSizing Range: 35 – 1000 bpAgilent Technologies
High Sensitivity D5000 ScreenTape KitSizing Range: 100 – 5000 bpAgilent Technologies
WaterBioperformance certified, Lot No. RNBJ7736Sigma-Aldrich
NEBuilder HiFi DNA Assembly Master MixCatalog number: E261SNew England BioLabs
CutSmart BufferCatalog number: B7204SNew England BioLabs
Lambda ExonucleaseCatalog number: M0262S, 5,000 units/mLNew England BioLabs
Library Construction KitLot: 160026, PN: 100019010X Genomics
KAPA Library Quantification (Illumina) Primers & LightCycler 480 qPCRMixLot:0000121161Roche
KAPA Library Quantification (Illumina) DNA Standards 1-6Lot: 0000120225Roche
Tween-20Lot: P9416Sigma-Aldrich
Table 1.1: Overview of chemicals/kits


Devices and Software
Device/SoftwareModel/DesignationManufacturer
Vortex MixerVortex-Genie 2Scientific Industries
PCR Thermal CyclersMastercycler X50seppendorf
Thermomixerwith thermoblocks for 24 reaction vessels 1.5 mL, 2 mLeppendorf
Magnetic Stand 0,2to 8 purifications in parallelThermo Fisher Scientific
ThermoblockThermoStat pluseppendorf
FluorometerQubit 3 FluorometerThermo Fisher Scientific
Mini-centrifugeRotilabo‱-mini-centrifuge "Uni-fuge"Carl Roth
CentrifugeCentrifuge 5427 Reppendorf
PCR Plate Spinnermax. capacity: 2 platesVWR International
Repetitive pipetteMultipette‱ E3xeppendorf
Charging StandCharging Stand 2 for one electronic Multipetteeppendorf
Dispenser tipsEppendorf Combitips advanced (0,1 ml, 0,5 ml, 2,5 ml)eppendorf
Pipette TipsxTip 4, low retention manual filter pipette tip (20 μL, 200 μL)Biotix
DNA LoBind Tubes1,5 mL, 0,5 mLeppendorf
Thin-walled Tubes with Flat Caps0.5 mLThermo Fisher Scientific
Pipette tipsSafeSeal-Tips Professional Line (10μL, 20 μL, 200μL, 1000μL)Biozym Scientific
PipettesEppendorf Research plus pipette (0.1–2.5μL, 0.5–10 μL, 2–20μL, 10–100 μL, 20–200μL, 100–1,000 μL)eppendorf
Multichannel pipettesPipet-Life XLS, 8-Channels (0.5-10 μL, 2-20 μL, 20-200 μL)RAININ
PCR 8er-SoftStrips0.2 mlBiozym Scientific
PCR TubesPCR-02-L-C, 0.2mL maximum recovery, thin wall, clearAxygen
PipettorPipetboy acu 2INTEGRA Biosciences
Serological pipettes5 mL, 10 mLSarstedt
Conical Centrifuge TubesFalconTM, 15mL, 50mLFisher Scientific
PCR plates for Roche LightCycler 480Catalog number: 732-1462, No. Of wells: 96VWR International
PCR Seal SheetsOptically clear film, adhesive seal. 140x77mm4titude
LightCycler 480 Sealing FoilREF: 04729757001Roche Molecular System
Optical Film Compression Pad4TI-05634titude
Benchtop CoolerStrataCooler LPAgilent Technologies
Vortex MixerIKA MS3 VortexerIKA
LightCycler 480 II SystemSerial number: 27785Roche
TapeStationAgilent 4200 TapeStation SystemAgilent Technologies
TapeStation Analysis Software-Agilent Technologies
Table 1.2: Devices and softwares


Primer
ABCD
Oligo nameSequence (5’ -> 3’)CommentManufacturer
TCRGOT_1GAGCAAGTATGTACCGTTCCAAGCAGTGGTATCAACGCAGAGIDT
TCRGOT_2GGAACGGTACATACTTGCTCCTACACGACGCTCTTCCGATCTIDT
TRAC_3UTR_1/5BiotinTEG/GTCTGGGCGTGTTGTATGTC5′-BiTEG modificationIDT
TRAC_3UTR_2/5BiotinTEG/GTGTTGTATGTCCTGCTGCC5′-BiTEG modificationIDT
TRBC1_3UTR/5BiotinTEG/CACACTCACGGCTGAAATCT5′-BiTEG modificationIDT
TRBC2_3UTR/5BiotinTEG/CCCTGAAGATTGAGCTCCCA5′-BiTEG modificationIDT
HTCR_o_alpha/5BiotinTEG/TGAAGGCGTTTGCACATGCA5′-BiTEG modificationIDT
HTCR_o_beta/5BiotinTEG/TCAGGCAGTATCTGGAGTCATTGAG5′-BiTEG modificationIDT
HTCR_i_alpha/5BiotinTEG/AGTCTCTCAGCTGGTACACG5′-BiTEG modificationIDT
HTCR_i_beta/5BiotinTEG/TCTGATGGCTCAAACACAGC5′-BiTEG modificationIDT
P5_SI_TTAATGATACGGCGACCACCGAGATCTACAC NNNNNNNNNN GTGACTGGAGTTCAGACGTG*TIDT
P5_SI-TT-A1AATGATACGGCGACCACCGAGATCTACAC GTAACATGCG GTGACTGGAGTTCAGACGTG*TIDT
P5_SI-TT-A2AATGATACGGCGACCACCGAGATCTACAC GTGGATCAAA GTGACTGGAGTTCAGACGTG*TIDT
P5_SI-TT-A3AATGATACGGCGACCACCGAGATCTACAC CACTACGAAA GTGACTGGAGTTCAGACGTG*TIDT
P5_SI-TT-A4AATGATACGGCGACCACCGAGATCTACAC CTCTAGCGAG GTGACTGGAGTTCAGACGTG*TIDT
P5_SI-TT-A5AATGATACGGCGACCACCGAGATCTACAC GTAGCCCTGT GTGACTGGAGTTCAGACGTG*TIDT
P5_SI-TT-A6AATGATACGGCGACCACCGAGATCTACAC TAACGCGTGA GTGACTGGAGTTCAGACGTG*TIDT
P5_SI-TT-A7AATGATACGGCGACCACCGAGATCTACAC TCCCAAGGGT GTGACTGGAGTTCAGACGTG*TIDT
P5_SI-TT-A8AATGATACGGCGACCACCGAGATCTACAC CGAAGTATAC GTGACTGGAGTTCAGACGTG*TIDT
P5_SI-TT-A9AATGATACGGCGACCACCGAGATCTACAC AAGTGGAGAG GTGACTGGAGTTCAGACGTG*TIDT
P5_SI-TT-A10AATGATACGGCGACCACCGAGATCTACAC CGTGACATGC GTGACTGGAGTTCAGACGTG*TIDT
P7_TRAC_3UTR_f3_i7CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCGNNNNNNNNNNGTATGTCCTGCTGCCGATGC*CIDT
P7_TRBC1_3UTR_f_i7CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCGNNNNNNNNNNACGGCTGAAATCTCCCTAACCCA*GIDT
P7_TRBC2_3UTR_f_i7CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCGNNNNNNNNNNGATTGAGCTCCCAACCCCCAA*GIDT
P7_TRAC_3UTR_f3_i7_A1CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG AGTGTTACCT GTATGTCCTGCTGCCGATGC*CIDT
P7_TRBC1_3UTR_f_i7_A1CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG AGTGTTACCT ACGGCTGAAATCTCCCTAACCCA*GIDT
P7_TRBC2_3UTR_f_i7_A1CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG AGTGTTACCT GATTGAGCTCCCAACCCCCAA*GIDT
P7_TRAC_3UTR_f3_i7_A2CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG GCCAACCCTG GTATGTCCTGCTGCCGATGC*CIDT
P7_TRBC1_3UTR_f_i7_A2CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG GCCAACCCTG ACGGCTGAAATCTCCCTAACCCA*GIDT
P7_TRBC2_3UTR_f_i7_A2CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG GCCAACCCTG GATTGAGCTCCCAACCCCCAA*GIDT
P7_TRAC_3UTR_f3_i7_A3CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG TTAGACTGAT GTATGTCCTGCTGCCGATGC*CIDT
P7_TRBC1_3UTR_f_i7_A3CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG TTAGACTGAT ACGGCTGAAATCTCCCTAACCCA*GIDT
P7_TRBC2_3UTR_f_i7_A3CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG TTAGACTGAT GATTGAGCTCCCAACCCCCAA*GIDT
P7_TRAC_3UTR_f3_i7_A4CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG TATCTTCATC GTATGTCCTGCTGCCGATGC*CIDT
P7_TRBC1_3UTR_f_i7_A4CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG TATCTTCATC ACGGCTGAAATCTCCCTAACCCA*GIDT
P7_TRBC2_3UTR_f_i7_A4CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG TATCTTCATC GATTGAGCTCCCAACCCCCAA*GIDT
P7_TRAC_3UTR_f3_i7_A5CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG GAGCATCTAT GTATGTCCTGCTGCCGATGC*CIDT
P7_TRBC1_3UTR_f_i7_A5CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG GAGCATCTAT ACGGCTGAAATCTCCCTAACCCA*GIDT
P7_TRBC2_3UTR_f_i7_A5CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG GAGCATCTAT GATTGAGCTCCCAACCCCCAA*GIDT
P7_TRAC_3UTR_f3_i7_A6CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG CCCTAACTTC GTATGTCCTGCTGCCGATGC*CIDT
P7_TRBC1_3UTR_f_i7_A6CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG CCCTAACTTC ACGGCTGAAATCTCCCTAACCCA*GIDT
P7_TRBC2_3UTR_f_i7_A6CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG CCCTAACTTC GATTGAGCTCCCAACCCCCAA*GIDT
P7_TRAC_3UTR_f3_i7_A7CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG TACTACCTTT GTATGTCCTGCTGCCGATGC*CIDT
P7_TRBC1_3UTR_f_i7_A7CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG TACTACCTTT ACGGCTGAAATCTCCCTAACCCA*GIDT
P7_TRBC2_3UTR_f_i7_A7CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGCG TACTACCTTT GATTGAGCTCCCAACCCCCAA*GIDT
Sequencing primers:readout:
spTCR_Read1 (90)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTVDJ sequenceIDT
spTCR_Read2 (28)CATACTTGCTCCTACACGACGCTCTTCCGATCTUMI and cell barcodeIDT
spTCR_Read3 (10)AGATCGGAAGAGCACACGTCTGAACTCCAGTCACi7 IndexIDT
spTCR_Read4 (10)CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGC*Gi5 IndexIDT
Table 1.3: Overview of the primers

Troubleshooting
Before start
  • Ensure that 3’-barcoded cDNA from the upstream single-cell / single-nucleus / spatial workflow is available, quantified, and stored at −20 °C or −80 °C.
  • Order and resuspend all primers and oligos used in the protocol (TCRGOT primers, TRAC/TRBC primers, outer/inner TCR primers, indexing primers, custom sequencing primers). Verify sequences and working concentrations.
  • Thaw and prepare all buffers and enzymes (KAPA HiFi HotStart ReadyMix, NEBuilder HiFi DNA Assembly Master Mix, Lambda exonuclease + buffer, AMPure XP beads, SPRIselect, 10x Genomics V(D)J reagents). Mix thoroughly and keep enzymes on ice.
  • Bring AMPure XP and SPRIselect beads to room temperature for at least 30 minutes and vortex well to ensure homogeneous suspension before use.
  • Pre-program thermal cyclers with all required PCR and incubation profiles (PCR#1, circularization, Lambda exonuclease digestion, V(D)J Amplification 1 & 2, fragmentation/A-tailing, adapter ligation, indexing PCR).

  • Verify access to all required equipment:
- Magnetic rack compatible with the tube/plate format used
- Qubit (or equivalent) with dsDNA HS assay kit
- TapeStation (or equivalent) with HS D5000 and D1000 ScreenTapes
- Refrigerated microcentrifuge
- Thermomixer or heating block with shaking option
- Illumina NextSeq 550 (or access to a facility that provides runs with the 90–28–10–10 configuration).

  • Prepare a clean PCR work area with filtered pipette tips, dedicated pipettes.
  • Plan sample layout, indices, and multiplexing strategy in advance to ensure non-overlapping sample indices in the sequencing run.
PCR #1 – amplification of 3’-barcoded cDNA
This step amplifies the 3’-barcoded cDNA and adds the Gibson assembly overhangs required for circularization.


Input: 1–15 ng of 3’-barcoded cDNA

Prepare PCR #1 reaction mix on ice

For each 25 μL reaction:
Component25 μL reactionFinal conc.
PCR-grade waterUp to 25 μLN/A
2X KAPA HiFi HotStart ReadyMix12.5 μL1X
10 μM TCRGOT_1 primer0.75 μL0.3 μM
10 μM TCRGOT_2 primer0.75 μL0.3 μM
3’-barcoded cDNA template1-15 ng1-15 ng
PCR#1 reaction mix

  • Assemble all components on ice.
  • Mix gently by pipetting and briefly spin down to collect liquid at the bottom.

PCR
PCR cycling

Place the tubes in a pre-cooled thermal cycler and run the following program (6 cycles of steps 3-5):

ABCD
StepTemperatureDurationCycles
Initial denaturation95 °C3 min1
Denaturation98 °C20 s6
Annealing65 °C30 s
Extension72 °C2 min
Final extension72 °C5 min1
PCR#1 programm design
  • Hold at 4 °C until proceeding to cleanup.
PCR

PCR #1 Cleanup

This cleanup removes primers, enzymes, and small fragments using AMPure XP beads.

  1. Bring the AMPure XP beads to the room temperature for at least 30 minutes and thoroughly vortex the to fully resuspend.
  2. Add 20 μL AMPure XP beads (0.9X) to each 25 μL PCR reaction.
  3. Mix by pipetting up and down ~15 times, or vortex.
  4. Incubate for 5 min at room temperature to allow DNA to bind to the beads.
  5. Place the tubes on a magnetic rack (high) for 5minutes or until the solution becomes clear and the beads are fully pelleted.
  6. Carefully remove and discard the supernatant without disturbing the bead pellet.
  7. Add 200 μL of freshly prepared 80% ethanol to the pellet and incubate for ~30 s.
  8. Remove the ethanol carefully.
  9. Repeat the ethanol wash (steps 7–8) for a total of 2 washes.
  10. Air-dry the bead pellet for 2-3 min (do not overdry; pellets should appear matte but not cracked).
  11. Remove the tubes from the magnet and add 20.5 μL EB buffer.
  12. Resuspend the beads thoroughly by pipetting up and down ~15 times, or vortex.
  13. Incubate for 2 min at room temperature to elute DNA.
  14. Place the tubes back on the magnet (low) until the solution clears.
  15. Transfer 20 μL of the clear supernatant to new tubes. This is your cleaned PCR #1 product.

PCR #1 Quality Control

Assess yield and fragment size distribution:

  • Qubit dsDNA HS assay – to quantify DNA concentration.
  • Agilent TapeStation HS D5000 – to confirm expected fragment size and absence of primer-dimers.

Circularization of cDNA
In this step, Gibson assembly is used to circularize the amplified cDNA.

Prepare circularization reaction

For each sample:

ComponentVolume
cDNA template15–20 ng
1X CutSmart bufferto 170 μL total
2X NEBuilder HiFi DNA Assembly Master Mix10 μL
circularization reaction mix
  • Combine cDNA, CutSmart buffer, and NEBuilder HiFi DNA Assembly Master Mix in a total reaction volume of 200 μL.
  • Mix thoroughly by pipetting and briefly spin down.
  • Incubate at 50 °C for 1 hour in a thermomixer or thermal cycler (optional gentle shaking).
  • After incubation, proceed immediately to the next step.


Circularization Cleanup

Purify the circularized cDNA using AMPure XP beads.

  1. Vortex (brought to the room temperature for at least 30min) AMPure XP beads to completely resuspend.
  2. Add 0.9X volume AMPure XP beads to each circularization reaction.
  3. Mix by pipetting 15 times.
  4. Incubate 5 min at room temperature.
  5. Place tubes on the magnet (high) until the solution is clear and beads are pelleted.
  6. Carefully remove and discard the supernatant.
  7. Add 200 μL 80% ethanol to the pellet and incubate ~30 s.
  8. Remove the ethanol carefully.
  9. Repeat the ethanol wash (steps 7–8) for a total of 2 washes.
  10. Air-dry the pellet for 2-3 min (avoid overdrying).
  11. Remove tubes from the magnet and add 20.5 μL EB buffer.
  12. Resuspend the beads thoroughly (pipette up and down ~15 times).
  13. Incubate 5 min at room temperature.
  14. Place tubes on the magnet (low) until the solution clears.
  15. Transfer 20 μL of the eluate to new tubes. This is the circularized cDNA.

Lambda Exonuclease Digestion

This step removes residual linear DNA, enriching for circular molecules.

Prepare the following mix for each sample:
ComponentVolume
Circularized DNA20 μL
10X Lambda Exonuclease Buffer5 μL
Lambda Exonuclease Enzyme1 μL
Nuclease-free H₂O24 μL
Total50 μL
Lambda Exonuclease Digestion Reaction Mix
a. Incubation

  • Incubate at 37 °C for 30 min to digest remaining linear DNA.

b. Enzyme inactivation

  • Stop reaction by adding EDTA to 10mM.
  • Heat-inactivate at 75 °C for 10 min.
  • Cool samples on ice or at 4 °C before proceeding to cleanup.
Post-digestion Cleanup

Purify the circularized, exonuclease-treated DNA using AMPure XP beads.

  1. Bring the AMPure XP beads to the room temperature for at least 30 minutes and thoroughly vortex the to fully resuspend.
  2. Add 0.8X volume AMPure XP beads to each 50 μL digestion reaction.
  3. Mix by pipetting ~15 times.
  4. Incubate 5 min at room temperature.
  5. Place tubes on the magnet until the solution is clear (~5 min).
  6. Remove the supernatant carefully.
  7. Add 80% ethanol to wash the beads (originally written as 2 mL; please confirm – other washes use 200 μL).
  8. Wait 30 s, then remove the ethanol.
  9. Repeat the ethanol wash for a total of 2 washes.
  10. Air-dry the pellet for 2-3 min.
  11. Remove tubes from the magnet and add 25.5 μL EB + 0.05% Tween-20.
  12. Resuspend beads thoroughly by pipetting ~15 times.
  13. Incubate 5 min at room temperature.
  14. Place tubes on the magnet (low) until the solution clears.
  15. Transfer 25 μL of eluate to new tubes. This is your circularized cDNA ready for V(D)J amplification.
Circularization QC

Evaluate DNA yield and fragment size:

  • Qubit dsDNA HS assay
  • Agilent TapeStation HS D5000
V(D)J Amplification 1 (outer PCR)
This nested PCR enriches TCR α and β V(D)J regions from circularized cDNA.

a. Prepare V(D)J 1 primer mix on ice
PrimerVolume
100 μM TRAC_3UTR_11 μL
100 μM HTCR_o_alpha1 μL
100 μM TRBC1_3UTR1 μL
100 μM TRBC2_3UTR1 μL
100 μM HTCR_o_beta1 μL
H₂O5 μL
Total10 μL
V(D)J primer mix
b. Prepare V(D)J Amplification 1 reaction mix on ice

ComponentVolumeFinal conc.
cDNA template22.5 μL—
2X KAPA HiFi HotStart ReadyMix25.6 μL1X
V(D)J 1 Primer Mix3.1 μL0.3 μM
Total51.2 μL
V(D)J amplification 1 reaction mix
  • Mix gently and briefly spin down.
PCR cycling
Run the following program:
StepTemperatureDurationCycles
Initial denaturation95 °C3 min1
Denaturation98 °C20 s12–15*
Annealing62 °C30 s
Extension72 °C1 min
Final extension72 °C1 min1
PCR programm design
*Use 12 cycles as default; increase up to 15 cycles for low T cell content or low DNA yield.
PCR
V(D)J Amplification 1 Cleanup

Purify the first V(D)J amplification using AMPure XP beads.

  1. Vortex AMPure XP beads thoroughly.
  2. Add 46.1 μL AMPure XP beads (0.8X) to each PCR reaction.
  3. Mix by pipetting 15 times.
  4. Incubate 5 min at room temperature.
  5. Place tubes on the magnet (high) until the solution clears.
  6. Carefully remove and discard the supernatant.
  7. Add 200 μL 80% ethanol to the pellet and incubate ~30 s.
  8. Remove ethanol.
  9. Repeat the ethanol wash for a total of 2 washes.
  10. Air-dry the pellet for 2-3 min.
  11. Remove from the magnet and add 10 μL EB buffer.
  12. Resuspend thoroughly by pipetting ~15 times.
  13. Incubate 5 min at room temperature.
  14. Place on the magnet (low) until the solution clears.
  15. Transfer 10 μL to new tubes. This is the template for V(D)J Amplification 2.
V(D)J Amplification 2 (inner PCR)
This second nested PCR further enriches TCR V(D)J sequences and introduces inner primers.

a. Prepare V(D)J 2 primer mix on ice
PrimerVolume
100 μM TRAC_3UTR_21 μL
100 μM HTCR_i_alpha1 μL
100 μM TRBC1_3UTR1 μL
100 μM TRBC2_3UTR1 μL
100 μM HTCR_i_beta1 μL
H₂O5 μL
Total10 μL
V(D)J 2 primer mix
b. Prepare V(D)J Amplification 2 reaction mix on ice (25 μL reaction)

Component25 μL reactionFinal conc.
cDNA template (from step 10)10 μL—
2X KAPA HiFi HotStart ReadyMix12.5 μL1X
V(D)J 2 Primer Mix1.5 μL0.3 μM
H₂O1 μLN/A
V(D)J 2 amplification mix
  • Mix gently, spin down briefly.
PCR cycling

StepTemperatureDurationCycles
Initial denaturation95 °C3 min1
Denaturation98 °C20 s10
Annealing62 °C30 s
Extension72 °C1 min
Final extension72 °C1 min1
PCR programm design
V(D)J Amplification 2 Cleanup

  1. Vortex AMPure XP beads thoroughly.
  2. Add 22.5 μL AMPure XP beads (0.9X) to each PCR reaction.
  3. Mix by pipetting 15 times.
  4. Incubate 5 min at room temperature.
  5. Place tubes on the magnet (high) until the solution clears.
  6. Remove and discard the supernatant.
  7. Add 200 μL 80% ethanol to the pellet; incubate ~30 s.
  8. Remove ethanol.
  9. Repeat the ethanol wash for a total of 2 washes.
  10. Air-dry the pellet for 2-3 min.
  11. Remove from magnet and add 20 μL EB buffer.
  12. Resuspend thoroughly (15× pipetting).
  13. Incubate 5 min at room temperature.
  14. Place on the magnet (low) until the solution clears.
  15. Transfer 20 μL to new tubes. This is your enriched V(D)J cDNA for library construction.
V(D)J Amplification QC

  • Qubit dsDNA HS assay – quantify DNA.
  • Agilent TapeStation HS D5000 – confirm size distribution and enrichment of V(D)J products.


Amplified TCR cDNA library from human PBMCs. Initial cDNA was generated with the 3’GEX v3.1 assay (10X Genomics)



V(D)J Library Construction
Proceed to “V(D)J Library Construction” from Chromium Next GEM Single Cell 5' v2 (Dual Index)

Input: 2-3 ng

Fragmentation, End Repair & A-tailing
a. Determine the volume for 25% concentration of sample. Dispense the sample volume in a tube on ice. If the volume required is less than 20 μL, adjust the total volume of each sample to 20 μL with nuclease-free water.
b. Vortex Fragmentation Buffer. Verify there is no precipitate.
c. Prepare Fragmentation Mix on ice. Pipette mix and centrifuge briefly.
ComponentPN1X (μL)4X + 10% (μL)
Nuclease-free Water-1566
Fragmentation Buffer2000091522
Fragmentation Enzyme2000090/20001041044
Total-30132
Fragmentation Mix

d. Add 30 μl Fragmentation Mix into each tube containing 20 μl sample.
e. Pipette mix 15x (pipette set to 30 μl) on ice. Centrifuge briefly.
f. Incubate (Lid Temperature: 65 °C):

StepTemperatureDuration
Fragmentation32 °C2 min
End repair & A-tailing65 °C30 min
Hold4 °Chold
Fragmentation thermal programm

Adaptor Ligation

a. Prepare adapter ligation mix
For each sample:
ComponentPN1X (μL)4X + 10% (μL)
Ligation Buffer20000922088
DNA Ligase220110/2201311044
Adapter Oligos20000942088
Total—50220
Adaptor Ligation Mix

Mix well by pipetting and spin down briefly.

b. Ligation reaction
  1. Remove samples from the thermal cycler.
  2. Add 50 μL Adapter Ligation Mix to each 50 μL fragmented sample (total 100 μL).
  3. Mix by pipetting 15× (pipette set to 90 μL).
  4. Spin down briefly.

c. Incubation
Incubate in a thermal cycler (lid at 30 °C):

StepTemperatureDuration
120 °C15 min
24 °Chold
Adaptor Ligation programm

Post Adaptor Ligation Cleanup - SPRIselect

  1. Vortex SPRIselect reagent thoroughly.
  2. Add 0.8X μL SPRIselect (80 μL) to each 100 μL ligation reaction.
  3. Mix by pipetting 15× (pipette set to 150 μL).
  4. Incubate 5 min at room temperature.
  5. Place tubes on the magnet (high) until the solution is clear.
  6. Remove and discard the supernatant.
  7. Add 200 μL 80% ethanol to the pellet; wait 30 s.
  8. Remove ethanol.
  9. Repeat the ethanol wash for a total of 2 washes.
  10. Briefly centrifuge and return the tubes to the magnet (low).
  11. Remove any residual ethanol and air-dry the pellet for 2 min.
  12. Remove tubes from the magnet and add 30.5 μL EB buffer.
  13. Resuspend beads thoroughly by pipetting 15× (continue mixing if beads appear clumpy).
  14. Incubate 5 min at room temperature.
  15. Place on the magnet (low) until the solution clears.
  16. Transfer 30 μL of the eluate to a new tube strip. This is the adapter-ligated DNA for indexing PCR.
Sample Index PCR

This step adds sample indices and completes library amplification.

a. Choose sample indices
Select appropriate sample index primers such that no indices overlap between samples in a multiplexed run.

b. Prepare Sample Index PCR reaction mix (example for sample 1)

ComponentVolume
Amp Mix (PN-2000047/2000103)50 μL
P7_TRAC_3UTR_f3_i7_A1 (10 μM)3 μL
P7_TRBC1_3UTR_f_i7_A1 (10 μM)3 μL
P7_TRBC2_3UTR_f_i7_A1 (10 μM)3 μL
P5_SI-TT-A1 (10 uM)3 μL
H₂O8 μL
Total70 μL
Sample Index PCR mix
(For additional samples, use the corresponding index primer pairs A2, A3, A4, etc.)

c. PCR setup
  1. Add 70 μL Sample Index PCR Reaction Mix to 30 μL of adapter-ligated DNA (total 100 μL).
  2. Mix gently and spin down.

d. PCR cycling
Run the following program (lid at 105 °C):

StepTemperatureDurationCycles
Initial denaturation98 °C45 s1
Denaturation98 °C20 s8
Annealing54 °C30 s
Extension72 °C20 s
Final extension72 °C1 min1
Sample Index PCR thermal programm
Post Sample Index PCR Cleanup – SPRIselect

  1. Vortex SPRIselect reagent thoroughly.
  2. Add 0.9X SPRIselect (90 μL) to each 100 μL PCR reaction.
  3. Mix by pipetting 15× (pipette set to 150 μL).
  4. Incubate 5 min at room temperature.
  5. Place on the magnet (high) until the solution clears.
  6. Remove the supernatant carefully.
  7. Add 200 μL 80% ethanol; wait 30 s.
  8. Remove ethanol.
  9. Repeat the ethanol wash for a total of 2 washes.
  10. Briefly centrifuge and place back on the magnet (low).
  11. Remove any residual ethanol and air-dry the pellet for 2 min.
  12. Remove from the magnet and add 25.5 μL EB buffer.
  13. Resuspend beads by pipetting 15×.
  14. Incubate 5 min at room temperature.
  15. Place on the magnet (low) until the solution clears.
  16. Transfer 25 μL of the eluate to a new tube strip.
  17. Store libraries at 4 °C for up to 72 h or at −20 °C for long-term storage.
Post Sample Index PCR QC

Perform final library QC:
  • Qubit dsDNA HS assay – for accurate concentration.
  • Agilent TapeStation HS D1000 – to verify the expected library size distribution and absence of major contaminants.


TCR short-read sequencing library

Library Quantification and Sequencing
qPCR quantification
  • Quantify final circVDJ-seq libraries using a suitable qPCR-based library quantification kit (e.g. for Illumina platforms), following the manufacturer’s instructions.

  • Normalize libraries to the desired loading concentration for NextSeq 550 Mid-Output runs.


Sequencing run setup
  • Sequence libraries on an Illumina System with the following custom read configuration: 90–28–10–10 (note that in contrast to the standard Illumina workflow, the library indices are sequenced in the last two sequencing cycles).

  • Use the following custom sequencing primers:
Primer nameRead (cycles)Sequence (5' → 3')
spTCR_Read1 (90)VDJ sequence (90)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
spTCR_Read2 (28)Cell barcode + UMI (28)CATACTTGCTCCTACACGACGCTCTTCCGATCT
spTCR_Read3 (10)i5 Index (10)AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
spTCR_Read4 (10)i7 Index (10)CAAGCAGAAGACGGCATACGAGATCTGAGTCAGTAGC*G
Custom Sequencing Primers



Protocol references