Jun 17, 2026
Generation of bulk heterozygous knock-in cells for targeted protein degradation
- Beibei Liu1,
- Tomoharu Kanie1
- 1Oklahoma University Health Campus
- Tomoharu Kanie: Corresponding author
Protocol Citation: Beibei Liu, Tomoharu Kanie 2026. Generation of bulk heterozygous knock-in cells for targeted protein degradation. protocols.io https://dx.doi.org/10.17504/protocols.io.rm7vzw87xvx1/v1
Manuscript citation:
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 17, 2026
Last Modified: June 18, 2026
Protocol Integer ID: 319374
Keywords: cells for targeted protein degradation, targeted protein degradation, cell cloning, eliminating protein, protein degradation, cell selection, genome editing, blasticidin resistance gene, following cell selection, essential gene, conditional degron, gene, molecule degrader, genomic polymerase chain reaction, workflow for degron, transactivating crispr rna, function of essential gene, cell, gene locus, diploid cell, degron, crispr rna, selected bulk knock, donor template
Funders Acknowledgements:
NIH
Grant ID: P20GM103447
NIH
Grant ID: 1R35GM151013
Disclaimer
The authors declare that no financial or non-financial competing interests exist.
Abstract
Targeted protein degradation is a powerful tool for investigating the function of essential genes by rapidly eliminating proteins with a small-molecule degrader. The first step of the technique is inserting a conditional degron-tag (CDT) into the gene locus. Traditionally, single-cell cloning is considered necessary to select homozygous knock-in cells harboring CDT, and its labor-intensive nature has limited the application of this valuable technology. We recently established a strategy to utilize bulk heterozygous knock-in cells for targeted protein degradation. In this approach, cells harbor a knock-in cassette containing the CDT in only one allele, while the other allele carries frameshift indels that result in functionally null variants, thereby bypassing the laborious single-cell cloning.
This protocol provides a detailed step-by-step guide for generating bulk heterozygous knock-in cells. The procedure starts with designing a donor template, which consists of a left homology arm (LHA), a mini-promoter (optional), a blasticidin resistance gene (BlastR), the self-cleaving peptides (P2A), V5-tag, the degron (FKBP12F36V, IKZF3d, or HaloTag), and a right homology arm (RHA). RPE1-hTERT (a genetically stable, near-diploid cell) stably expressing Blue Fluorescent Protein (BFP) tagged Cas9 is then transfected using Lipofectamine 3000 with a CRISPR RNA (crRNA) targeting immediately downstream of the start codon of a gene of interest (GOI), a transactivating CRISPR RNA (tracrRNA), and the donor template. Following cell selection with blasticidin, genome editing is confirmed by genomic Polymerase Chain Reaction (PCR) analysis. Once the frameshift insertion/deletion (indel) of the non-knock-in allele is confirmed, the selected bulk knock-in cells can be used directly for downstream applications without clonal expansion. Our method simplifies the workflow for degron-tag knock-ins and broadens the applicability of these valuable technologies.
Materials
- Custom Alt-R CRISPR-Cas9 guide RNA tool
- Alt-R crRNA
- Alt-R tracrRNA
- Nuclease-Free Duplex Buffer
- 1.5 mL microcentrifuge tube (05-408-129, Fisher Scientific)
- Heat block (6875SB, Corning)
- 10 μL barrier pipette tips (02-682-265, Thermo Scientific)
- 200 μL barrier pipette tips (PR-200RK-FL, PR1MA™)
- 1250 μL barrier pipette tips (PR-1250RK-FL, PR1MA™)
- Q5® High-Fidelity DNA Polymerase (M0491S, New England BioLabs)
- 0.2 mL 8-strip PCR tubes (14-230-215, Fisher Scientific)
- Minicentrifuge (4ES0201001-USA, Four E's Scientific)
- Thermal cycler (TC-32, Benchmark)
- 6×loading dye (B7024A, New England BioLabs)
- 1 % agarose gel (16500500, Invitrogen)
- 0.5×TAE buffer
- MaestroSafe Pre-Stained Nucleic Acid dye (MR-031203, Transilluminators.com)
- 1kb ladder (N3232S, New England BioLabs)
- Mini electrophoresis system (E1101, Accuris Instrument)
- Blue Light Transilluminator (NEB-SLB-01W, Transilluminators.com)
- Razor Blade (12-640, Fisher Scientific)
- Zymoclean Gel DNA Recovery Kit (D4002, Zymo Research)
- Nanodrop (ND-1000, Thermo Scientific)
- 10 cm dish
- DMEM/F-12 (12400-024, Invitrogen)
- FBS (100-106, Gemini)
- GlutaMax (35050-061, Gibco)
- Penicillin-Streptomycin (15140122, Thermo Fisher Scientific)
- Trypsin-EDTA (25300062, Thermo Fisher Scientific)
- 15 mL conical tube (12-565-268, Thermo Fisher Scientific)
- Sorvall ST8 (Thermo Scientific)
- Phosphate-buffered saline (PBS) (21-600-069, Fisher Scientific)
- Hemocytometer (3100, Hausser Scientific)
- 24-well plate (FB012929, Fisher Scientific)
- Lipofectamine 3000
- Opti-MEM
- Blasticidin (14499, Cayman Chemical)
- 6-well plate (12-556-004, Thermo Scientific)
- Dimethyl sulfoxide (D2650-100ML, SIGMA)
- Cryogenic vial (430487, Corning)
- Lysis buffer [10 mM Tris-HCl (pH 7.6), 50 mM NaCl, 6.25 mM MgCl2, 0.045% NP40, 0.45% Tween-20]
- Proteinase K (EO0491, Thermo Scientific)
- DreamTaq DNA Polymerase (EP0702, Thermo Scientific)
Safety warnings
Since the DNA polymerase used here is non-hot-start, ensure the samples are prepared on ice.
Before start
Ensure that the pipette tips and microcentrifuge tubes used for the gRNA preparation are DNase- and RNase-free.
Design and planning
crRNA design and ordering
Design crRNAs with the IDT Custom Alt-R CRISPR-Cas9 guide RNA tool (https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM). Provide an 80–100 bp genomic sequence centered on the START codon of your gene of interest. Choose a crRNA whose Cas9 cut site falls immediately downstream of the START codon; In ideal case, the predicted crRNA cut site is right at the START codon, so that the start codon of the non-knock-in allele is disrupted after the Non Homologous End Joining (NHEJ) regardless of the type of insertion/deletion (frame-shift or non-frame-shift).
If no such crRNA is available, select one that cuts further downstream of the START codon and reintroduce the excised region between the degron-tag and RHA of the donor cassette. Apply codon-optimization to the reintroduced fragment so that it no longer matches the native sequence. This avoids primer dimer formation during donor-template PCR and prevents the reinforced sequence from binding to the LHA binding site in genomic DNA. When several crRNAs qualify, also weigh:
• highest predicted on-target cut efficiency
• lowest predicted off-target specificity
As an example, we selected the 5’- tcccgagcgcgacaccatgt-3’ sequence for generating CDT knock-in cells for DYNC1H11. The predicted cut site (3 bp upstream of the Protospacer Adjacent Motif (PAM) sequence) is between the 1st and 2ndnucleotides of the coding DNA sequence (CDS) of the DYNC1H1 gene (CCDS9966.1). The predicted on-target cut efficiency score was 45 (moderate to low) and the off-target specificity score was 94 (highly specific), indicating good specificity but potentially low cutting efficiency at this site. Despite the low predicted on-target cut efficiency score, this crRNA successfully yielded CDT-knock-in cells.
Homology-Directed Repair (HDR) donor DNA design
To insert the degron-tag into the gene locus, PCR-amplified double-stranded DNA from an HDR donor cassette plasmid is used as the HDR donor template. To generate the HDR donor template, design a pair of ~60-mer oligonucleotides as PCR primers, each with 40 nucleotides that are homologous to the insertion site at the 5'-end and ~20 bases of the donor cassette plasmid-annealing sequence at the 3'-end. The donor cassette plasmids are available from Addgene (ID: 251478-251486) and contain: mini-promoter (optional)—blasticidin resistance gene (BlastR)—P2A peptide—V5 tag—degron (FKBP12F36V, IKZF3d, or HaloTag). Because of the P2A self-cleaving peptide, the blasticidin-resistance protein and the degron-tagged fusion protein are translated as separate polypeptides from the endogenous insertion locus. After the blasticidin selection, all cells harbor the degron tag on at least one allele. As an example, a pair of primers used to generate CDT knock-in cells for the DYNC1H1 gene1 are:
(1) DYNC1H1-forward 5’-cgccttctcatcgctcctggaaggtcgagcgcgacaccccGGCAGCATGGCCAAGCCTTTGTCTCAAGAA-3’
Nucleotides shown in lowercase are homologous to the 40-bp region immediately upstream of the CDS of the DYNC1H1 gene (CCDS9966.1). 6-bp shown in bold uppercase represents kozak sequence. 23-bp shown in non-bold uppercase anneals with the 5’ end of the donor cassette of the HDR donor cassette plasmid (Addgene ID: 251478).
(2) DYNC1H1-reverse 5’-cggccgagccgtcctcgccgccgccgcccccgggctccgaACTGACGGATCCAGCCTT-3’.
Nucleotides shown in lowercase are homologous to the 40-bp region immediately downstream of the CDS of the DYNC1H1 gene (CCDS9966.1). The 18-bp sequence shown in non-bold uppercase anneals with the 3’ end of the donor cassette of the HDR donor cassette plasmid (Addgene ID: 251478)
Genotyping primer design
Genotyping of genomic DNA of the knock-in bulk cells serves as a rapid validation: The knock-in allele appears as up-shifted bands on a 1% agarose gel. Design PCR primers to yield a ~400 bp amplicon on the parental genome centered on the predicted cut site. We use the Primer3-powered primer wizard in Benchling. Optimal Tm is set to 60°C. One of the PCR primers can be used as a Sanger sequencing primer, provided it is 130-200 bp from the predicted cut site. As an example, a pair of primers used for genotyping DYNC1H1 knock-in cells are: DYNC1H1-geno-forward 5’-GCGCCGAGACTACAAGTCCC-3’; DYNC1H1-geno-reverse 5’-GCAGACAAAGCGACCCCATTGT-3’. The size of amplicon is 897 bp, as we could not find a good primer pair that can create a ~400 bp amplicon. DYNC1H1-seq-reverse5’- CAGGGCGCTCTTCTCCTCCA -3’, which is 165 bp apart from the predicted CRISPR/Cas9 cut site, was used as a sequence primer
Section 1: gRNA preparation
crRNAs are designed with the ‘Custom Alt-R CRISPR-Cas9 guide RNA’ tool and ordered from IDT.
Note: Ensure that the pipette tips and microcentrifuge tubes used for the gRNA preparation are DNase- and RNase-free. We use 10 µL barrier pipette tips (02-682-265, Thermo Scientific), 200 µL barrier pipette tips (PR-200RK-FL, PR1MA‱), and 1250 µL barrier pipette tips (PR-1250RK-FL, PR1MA‱).
Resuspend Alt-R crRNA and Alt-R tracrRNA separately in Nuclease-Free Duplex Buffer (supplied by IDT with the purchase of Alt-R crRNA/tracrRNA) to 100 µM each; keep on ice.
Anneal the guide RNA: mix 5μl of 100 μM crRNA and 5μl of 100 μM tracrRNA in a 1.5 mL microcentrifuge tube (05-408-129, Fisher Scientific).
Heat the mixture in a heat block (6875SB, Corning) at 95 °C for 5 min.
Cool the mixture to room temperature on the benchtop for 5 min. The annealed 50 µM gRNA is ready to use. We recommend to prepare the gRNA immediately before the transfection for best results.
Section 2: HDR template preparation
The HDR donor cassette is prepared by PCR amplification from the donor-cassette plasmid using Q5‱ High-Fidelity DNA Polymerase, followed by gel purification to obtain a clean, error-free double-stranded DNA template ready for transfection.
PCR. Perform this step on ice. Use Q5‱ High-Fidelity DNA Polymerase (M0491S, New England BioLabs) for the PCR. Prepare a PCR master mix by mixing water, buffer, dNTPs, and Q5‱ High-Fidelity DNA Polymerase (without primers and the template plasmid).
Note: Since the DNA polymerase used here is non-hot-start, ensure the samples are prepared on ice.
50 µL reaction system:
| Contents | Volume | |
| 5X Q5 Reaction Buffer | 10 µL | |
| dNTP Mix (10 mM each) (R0191, Thermo Scientific) | 1 µL | |
| Forward primer (10 µM) | 2.5 µL | |
| Reverse primer (10 µM) | 2.5 µL | |
| HDR donor-cassette plasmid | 100 pg | |
| Q5‱ High-Fidelity DNA Polymerase | 0.5 µL | |
| 5X Q5 High GC Enhancer (optional) | (10 µL) | |
| Water, nuclease-free (#R0581) | To 50 µL |
Note: Use Q5 High GC enhancer if the target is GC-rich (≥ 65% GC)
Aliquot the master mix into 0.2 mL 8-strip PCR tubes (14-230-215, Fisher Scientific) and then add primers and HDR donor-cassette plasmid template.
a. Gently mix the samples by flicking the tubes and briefly centrifuge in a minicentrifuge (4ES0201001-USA, Four E's Scientific). Place the reactions in a pre-heated thermal cycler (TC-32, Benchmark). Perform PCR using the following program:
| Step | Temperature, °C | Time | |
| Initial denaturation | 98 | 30 s | |
| Denaturation | 98 | 10 s | |
| Annealing | 60 | 30 s | |
| Extension | 72 | 1-2 min* | |
| Final extension | 72 | 5 min | |
| Hold | 4 |
(2)-(4) for 30 cycles
*20–30 seconds/kb; we recommend adding an extra 30s for the extension time.
For example, if the PCR product is 2 kb, set extension time to 90 s.
Add 10 µL of 6xloading dye (B7024A, New England BioLabs) to 50 µL of PCR products, mix, and load 60 µL of the mixture on a 1 % agarose gel (16500500, Invitrogen) prepared in 0.5xTAE buffer (20 mM Tris-HCl and 0.5 mM EDTA) with 0.001% (v/v) MaestroSafe Pre-Stained Nucleic Acid dye (MR-031203, Transilluminators.com). Load 5 µl of 1kb ladder (N3232S, New England BioLabs) for DNA size estimation.
DNA electrophoresis in 0.5xTAE buffer at 100V for 30 minutes using a mini electrophoresis system (E1101, Accuris Instrument).
Visualize the DNA on a Blue Light Transilluminator (NEB-SLB-01W, Transilluminators.com) and excise the DNA of the expected band size using a Razor Blade (12-640, Fisher Scientific). Recover DNA from agarose gels using Zymoclean Gel DNA Recovery Kit (D4002, Zymo Research). Elute the DNA in 10 µl of DNA elution buffer included in the Gel DNA recovery kit.
Measure the recovered DNA using Nanodrop (ND-1000, Thermo Scientific). The eluted DNA products are then ready to use as the donor DNA cassette. We typically obtain 100~200 ng/µl DNA with 260/280 = 1.8~1.9 and 260/230 = 2.2~2.3
Section 3: Transfection
Day -3: Seed RPE-BFP-Cas9 cells in a 10 cm dish in fresh complete growth medium [DMEM/F-12 (12400-024, Invitrogen) supplemented with 10% FBS (100-106, Gemini), 1xGlutaMax (35050-061, Gibco), 100 U/mL Penicillin-Streptomycin (15140122, Thermo Fisher Scientific)] at 37 °C in 5% CO2. RPE-BFP-Cas9 cells were generated by infecting hTERT RPE-1 (CRL-4000, ATCC) with the lentivirus carrying Cas9-BFP (the transfer vector p293 Cas9-BFP used for lentivirus generation is a generous gift from Dr. Michael Bassik), followed by bulk BFP-positive cell sorting2.
Day -1: Plating the RPE-BFP-Cas9 cells
Aspirate the culture media and add 3 mL of phosphate-buffered saline (PBS) (21-600-069, Fisher Scientific) to wash the cells. Aspirate PBS and add 1ml of 0.05% Trypsin-EDTA (25300062, Thermo Fisher Scientific). Incubate the plate for 5 minutes at 37°C in a CO2 incubator (NU-5800, NUAIRE) to detach the cells. Neutralize trypsin with 2 mL of the complete growth medium, transfer the cells into a 15 mL conical tube (12-565-268, Thermo Fisher Scientific), and centrifuge (Sorvall ST8, Thermo Scientific) the tube at 500 g for 2 minutes at room temperature. Aspirate the supernatant and resuspend the cells in 2 mL of complete growth medium. Count the cells using a hemocytometer (3100, Hausser Scientific) and plate them at 5x104 cells/well in a 24-well plate (FB012929, Fisher Scientific) with 0.5 mL complete growth medium. Include a transfection-reagent-only sample as a negative control.
Day 1: Transfection. Prepare the two mixtures per well in 1.5 mL microcentrifuge tubes:
a. Mixture 1 (transfection reagent):
| Component | Amount per tube | |
| Opti-MEM | 23.5 µL | |
| Lipofectamine 3000 | 1.5 µL |
Add the 1.5 µL Lipofectamine 3000 directly into the 23.5 µL Opti-MEM. Tap to mix, brief spin, and incubate at room temperature for 5 min.
Note: The transfection reagent should not come into contact with the tube, as it may attach to the tube and decrease transfection efficiency.
b. Mixture 2 (nucleic acid mix):
| Component | Amount per tube | |
| Opti-MEM | 24 µL | |
| HDR donor DNA | 30 fmol | |
| 50 µM gRNA | 15 pmol | |
| P3000 reagent | 1 µL |
Tap to mix, brief spin, incubate at RT for 5 min.
Note: mole amount can be calculated from mass using NEBioCalculator (https://nebiocalculator.neb.com/#!/dsdnaamt)
Add Mixture 2 to Mixture 1, tap the tube to mix, brief spin, and incubate at room temperature for 15 min. During this incubation, aspirate the cell culture media of RPE-BFP-Cas9 cells grown in a 24-well plate and add 500 µl of antibiotic-free growth medium [[DMEM/F-12 (12400-024, Invitrogen) supplemented with 10% FBS (100-106, Gemini), 1xGlutaMax (35050-061, Gibco)]. Then add the combined mixture to the cells.
Note: Ensure that the pipette tips and microcentrifuge tubes for the gRNA preparation are DNase- and RNase-free.
Incubate cells at 37°C in a 5% CO2 incubator for 72 hours.
Day 4: Selection. Remove the culture medium and rinse each well with 0.5 mL PBS; detach cells with 0.1 mL 0.05% Trypsin-EDTA at 37°C for 5 min. Neutralize the Trypsin-EDTA with 0.4 mL of the complete growth medium containing 12.5 µg/mL blasticidin (14499, Cayman Chemical) and re-plate 0.5 mL cell suspension into a new 24-well plate so that the final blasticidin concentration in the well is 10 µg/mL.
Continue blasticidin selection; medium change is not required. Selection is complete when all cells in the transfection-reagent-only control well are dead (It takes roughly 8-10 days). After the selection, we typically observe 10-20 colonies on a plate. Success rate depends on the gRNA and the HDR template.
Expand the cells in a new 6-well plate. Remove the culture medium and rinse each well with 0.5 mL PBS; detach cells with 0.1 mL 0.05% Trypsin-EDTA at 37°C for 5 min. Neutralize the Trypsin-EDTA with 0.4 mL of the complete growth medium. Add all the cell suspension into a 6-well plate (12-556-004, Thermo Scientific) with 2mL of the complete growth medium. We do not add blasticidin once all the cells in the negative control (no gRNA) are dead.
Expand the cells in a 10 cm dish. Once the cells reach 80-90% confluency, replate them into a 10 cm dish. To replate, rinse each well with 1 mL PBS; detach cells with 0.3 mL 0.05% Trypsin-EDTA at 37°C for 5 min. Neutralize the Trypsin-EDTA with 0.7 mL of the complete growth medium. Add all the cell suspension to a 10 cm dish (12-556-002, Thermo Scientific) containing 10 mL of complete growth medium.
Prepare freeze stocks and samples for genomic DNA analysis. Once the cells reach 80-90% confluency, rinse each well with 3 mL PBS; detach cells with 1 mL 0.05% Trypsin-EDTA at 37°C for 5 min. Neutralize the Trypsin-EDTA with 2 mL of the complete growth medium, and transfer the cell suspension to a 15 mL conical tube. Centrifuge the tube at 500 g for 2 minutes at room temperature, and aspirate supernatant. Resuspend the cells in 3 mL of complete growth medium and count them using a hemocytometer (3100, Hausser Scientific). Put 950 µl of cell suspension into a cryogenic vial (430487, Corning) and mix it with 50 µl of dimethyl sulfoxide (D2650-100ML, SIGMA) to create a freeze stock. Create one more freeze stock tube. Plate 200,000 cells into a 6-well plate for genomic DNA analysis. After growing the cells for 48 hours, detach the cells as described in step 8. Transfer 1 mL of cell suspension into a 1.5 mL microcentrifuge tube, centrifuge (5424, Eppendoff) the tube at 500g for 2 minutes at room temperature, and rinse the cell pellet with 1 mL of PBS. Centrifuge the tube at 500 g for 2 minutes at room temperature, remove the supernatant, and store the cell pellet at -80°C until genomic DNA extraction.
Section 4. Validation: genotyping and ICE CRISPR analysis
To validate the bulk knock-in cells, genomic DNA is extracted from post-selected cells, and the target locus is amplified by genotyping PCR, followed by Sanger sequencing. The resulting chromatograms are analyzed using ICE CRISPR Analysis to confirm frameshift indels in the non-knock-in allele.
Genomic DNA extraction:
Thaw the cell pellets and flick the tube to dislodge the cells.
Resuspend the cells in 100 μL lysis buffer [10 mM Tris-HCl (pH 7.6), 50 mM NaCl, 6.25 mM MgCl2, 0.045% NP40, 0.45% Tween-20].
Add 1 μL of 20 mg/mL proteinase K (EO0491, Thermo Scientific) and mix well by tapping and inverting the tube, then briefly centrifuge (4ES0201001-USA, Four E's Scientific).
Incubate the mixture in a heat block (6875SB, Corning) at 56 °C for 1 hour.
Inactivate the proteinase K in a heat block at 95 °C for 15 min. The genomic DNA should be stable for at least several months at 4 °C.
Genotyping PCR:
Use DreamTaq DNA Polymerase (EP0702, Thermo Scientific) for the Genotyping PCR. Prepare a PCR master mix by combining water, buffer, dNTPs, and DreamTaq DNA Polymerase, without primers or a genomic DNA template.
50 μL reaction system:
| Contents | Volume | |
| 10X DreamTaq Buffer | 5 µL | |
| dNTP Mix (10 mM each) (R0191, Thermo Scientific) | 1 µL | |
| Forward primer (10 µM) | 0.5 µL | |
| Reverse Primer (10 µM) | 0.5 µL | |
| Genomic DNA template | 1 µL | |
| DreamTaq DNA Polymerase | 1.25 U | |
| Water, nuclease-free (#R0581) | To 50 µL |
Note: Since the DNA polymerase used here is non-hot-start, ensure the samples are prepared on ice.
Aliquot the master mix into 0.2 mL 8-strip PCR tubes and then add primers and genomic DNA templates.
Gently mix the samples by flicking the tube and briefly centrifuge. Place the reactions in a pre-heated thermal cycler. Perform PCR using the following program:
| Step | Temperature, °C | Time | |
| Initial denaturation | 95 | 2 min | |
| Denaturation | 95 | 30 sec | |
| Annealing | 60 | 30 sec | |
| Extension | 72 | 1-2 min* | |
| Final extension | 72 | 5 min | |
| Hold | 4 |
(2)-(4) for 40 cycles.
*The recommended extension step is 1 min for the PCR products up to 2 kb. For longer products, the extension time should be prolonged by 1 min/kb.
Add 10 μL of 6×loading dye to 50 μL of PCR products, mix, and load 60 μL of the mixture on a 1.5 % agarose gel with 0.001% MaestroSafe Pre-Stained Nucleic Acid dye. Load 5 μl of 100 bp ladder (N3231S, New England BioLabs) for DNA size estimation.
DNA electrophoresis in 0.5×TAE buffer at 100V for 30 minutes using mini electrophoresis system (E1101, Accuris Instrument).
Visualize the DNA on a Blue Light Transilluminator (NEB-SLB-01W, Transilluminators.com). Two bands are expected to be observed: a lower band representing the genomic DNA region flanked by the primer set (non-knock-in allele) and a higher band representing the genomic DNA region plus the donor cassette (knock-in allele). Excise the lower DNA band using a Razor Blade (12-640, Fisher Scientific). Recover DNA from agarose gels using a Zymoclean Gel DNA Recovery Kit (D4002, Zymo Research). Elute the DNA in 8 μl of DNA elution buffer included in the Gel DNA recovery kit.
Measure the recovered DNA using Nanodrop. The eluted DNA products are then ready to use as the donor DNA cassette. We typically obtain 30-100 ng/μl DNA with 260/280=1.5-1.8 and 260/230=1.0-2.3. Concentration and quality vary among samples, but we do not observe substantial differences in Sanger sequencing quality.
Send eluted DNA to Sanger sequencing (Eurofins Genomics).
ICE CRISPR Analysis (2025, v3.0. EditCo Bio).
Prepare two files: a ZIP archive containing the .ab1 files and an Excel spreadsheet with the definitions for the .ab1 files.
Go to https://ice.editco.bio/#/ and upload the files.
Analyze the chromatograms with ICE CRISPR Analysis to assess insertions/deletions in the non-knock-in allele.
Once the frameshift indel of the non-knock-in allele is confirmed, the selected bulk knock-in cells can be used directly for downstream applications without clonal expansion.
Note: In our experiment, 70-80% of samples had either dominant frame-shift indels or the START codon (ATG) deleted.
Section 5. Validation of knock-in by immunoblot and Drug-induced target degradation
Once successful knock-in and indels in the non-knock-in allele are confirmed by genomic DNA analysis, validate the expression of the degron-tag fusion protein and the depletion of the endogenous protein by immunoblotting using an anti-V5 antibody (13202S, Cell Signaling Technology) and an antibody against the endogenous protein. Follow the next steps to verify protein degradation by a small-molecule degrader.
Plate the knock-in RPE cells into a 6-well plate at a density of 2×10^5 cells/well with 2 mL complete growth medium, and grow them in a CO2 incubator at 37°C for 48 hours. Have two wells per sample for drug treatment and dimethyl sulfoxide (DMSO) control.
Replace the media with complete growth medium with either 0.1% (v/v) DMSO or an appropriate small-molecule degrader.
| Degron system | Degrader | Stock Concentration | Working Concentration | |
| dTAG | FKBP12 PROTAC dTAG-13 | 1 mM in DMSO | 1 µM | |
| IKZF3d | Pomalidomide | 1 mM in DMSO | 1 µM | |
| HaloTag | HaloPROTAC3 | 1 mM in DMSO | 1 µM |
Incubate the cells with the drug (or DMSO) for 24 hours.
Lyse the samples and perform Western blot.
Once drug-induced degradation is confirmed, the cells are ready for functional assays.
Protocol references
1. Liu B, Qi C, Kanie T. A bulk cell heterozygous knock-in strategy for targeted protein degradation. bioRxiv. 2026. Epub 20260521. doi: 10.64898/2026.05.19.726384. PubMed PMID: 42239119; PMCID: PMC13228484.
2. Kanie T, Abbott KL, Mooney NA, Plowey ED, Demeter J, Jackson PK. The CEP19-RABL2 GTPase Complex Binds IFT-B to Initiate Intraflagellar Transport at the Ciliary Base. Dev Cell. 2017;42(1):22-36 e12. Epub 20170615. doi: 10.1016/j.devcel.2017.05.016. PubMed PMID: 28625565; PMCID: PMC5556974.