Mar 01, 2024

GENERATING THE POOLED SINGLE GUIDE RNA LIBRARIES

This protocol is a draft, published without a DOI.
  • 1Garvan Institute of Medical Research, Sydney, NSW 2010, Australia;
  • 2Garvan Weizmann Center for Cellular Genomics, Garvan Institute of Medical Research, Sydney, NSW 2010, Australia;
  • 3Aligning Science Across Parkinson’s (ASAP) Collaborative Research Network, Chevy Chase, MD 20815, USA;
  • 4School of Medical Science, University of New South Wales, Sydney, NSW, 2052, Australia;
  • 5Graduate School of Biomedical Engineering, University of New South Wales, Sydney, NSW, 2052, Australia;
  • 6The Centre for Stem Cell Biology, Developmental Biology Program, Sloan Kettering Institute for Cancer Research, New York, NY, USA;
  • 7Ann Romney Center for Neurologic Diseases, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115, USA;
  • 8The New York Stem Cell Foundation Research Institute, New York, NY, USA
Icon indicating open access to content
QR code linking to this content
Protocol CitationHelaine Graziele Santos Vieira, Helen E. King, Renuka Ravi Gupta, Nona Farbehi, hendersa , Vikram Khurana, Gist Croft, Lorenz Studer, Joseph Powell 2024. GENERATING THE POOLED SINGLE GUIDE RNA LIBRARIES. protocols.io https://dx.doi.org/
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: February 29, 2024
Last Modified: May 31, 2024
Protocol  Integer ID: 95926
Keywords: ASAPCRN, Perturb -Seq, CRISPRi, NGS sequencing, pooled single guide rna, crispr inactivation with scrna, pooled single guide rna library, single guide rna, single guide rna libraries this protocol, genes within midbrain dopaminergic, mda neuron, scrna, crispr inactivation, cell rna, next generation sequencing, rna, crispri technology, crispr, midbrain dopaminergic, candidate gene, gene, neuron, sequencing, chosen gene perturbation, mrna, dual guides1
Funders Acknowledgements:
ASAP
Grant ID: ASAP-000472
Abstract
This protocol outlines the designing, cloning, and next-generation sequencing (NGS) of a pooled single guide RNA (sgRNA) library used with CRISPRi technology to knock down (KD) genes within midbrain dopaminergic (mDA) neurons. Dual guides1 have been designed to target 30 candidate genes that regulate cytoskeletal function, Ca2+ homeostasis, and mRNA metabolism. The causative role of these candidate genes in post-mitotic mDA neurons is yet to be characterised transcriptomically through single-cell RNA sequencing (scRNA-seq) Our objective is to elucidate the impact of our chosen gene perturbations in post-mitotic mDA neurons due to CRISPR inactivation with scRNA-seq.
Attachments
Materials

ABC
MATERIALCOMPANYCATALOG
A base Lentiviral Vector: pJR85Addgene140095
An insert from: pJR89Addgene140096
Library Oligo PoolTwist BioscienceCustom Ordered
FastDigest Bpu 1102l Thermo Fisher ScientificFD0094
FastDigest BstXIThermo Fisher ScientificFD1024
BsmBI-v2New England Biolabs (NEB)R0739S
T4 DNA LigaseNew England Biolabs (NEB)M0202S
PvuINew England Biolabs (NEB)R0150S
NEB Stable Competent E. coli (High Efficiency) New England Biolabs (NEB)C3040H
KAPA HiFi Hotstart PCR KitRocheKK2502

Before start
  1. Introduction:
For our dual gRNA libraries, we use the following three elements:
A base Lentiviral Vector: pJR85
  • Lentiviral CRISPR guide vector expressing an eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region.
  • The BsmBI sites were removed to allow for programmed dual sgRNA library cloning.
A insert from: pJR89
  • This plasmid contains sgRNA constant region and hU6 insert for programmed dual sgRNA cloning.
  • The sgRNA constant region contains a capture sequence (cs1) in the stem loop for direct capture Perturb-seq

Figure 1: Figure illustrating the programmed dual-guide library cloning strategy. Paired sgRNA targeting sequences are synthesized on individual oligos and inserted into a direct-capture Perturb-seq vector through ligation. Subsequently, an sgRNA constant region and hU6 promoter are introduced between the sgRNA targeting sequences, resulting in the completion of the final vector. This example depicts the design of a CR3cs1/CR1cs1 library. Repogle et al. 1

Library oligo pools:
  • The 10x Genomics compatible sgRNA library oligo pool was designed in silico by Weatherhitt Lab (Garvan) and was ordered from Twist Bioscience.
Synthesizing sgRNA oligonucleotides
The library oligo pool was designed in silico by the Weatheritt Lab (Garvan) and was ordered from Twist Bioscience. We utilised two in-silico tools FlashFry4 and CRISPRDO2, for guide design. Per gene, we designed two dual guides containing two sgRNAs targeting the interest gene. These are the protospacer, PS1, and PS2 sequences found in Figure 1 above. We ordered a pool of oligo with PS1-constant region as per Supplementary in Repogle et al. 1 and an example to target TP53 is below:

sgTP53
TCACAACTACACCAGAAGCCACCTTGTTGGAGGGAAGCGTGTCACCGTCGGTTTCAGAGCGAGACGTGTTTGATCTCGGGCCGTCTCAGAAACATGGAAGTCTAGAGCCACCGTCCAGTTTAAGAGCTAAGCTGGCAACACTTTGACGAAGA

where:
PCR Adapters 002:
Fwd -TCACAACTACACCAGAAG
Rev - GCAACACTTTGACGAAGA
Red rest. enzyme sites
Photospacer A - AGGGAAGCGTGTCACCGTCG
Photospacer B - AAGTCTAGAGCCACCGTCCA
CR3/cs1 paper sequence between photospacers-
GTTTCAGAGCGAGACGTGTTTGATCTCGGGCCGTCTCAGAAACATG
  • Prioritised guides that are found to be reported in hCRISPRi3 .
  • Prioritised guides that are found replicated across CRISPRDO2, FlashFry4 and with high specificity score (Moreno-Mateos2015 On Target) and low off-target score (Hsu2013).
  • Do not target known common variants found across the Parkinson’s Progression Markers Initiative (PPMI) cohort.
  • Do not contain enzyme restriction sites BstXI/Blp that are used within the dual guide strategy reported.
  • Paired dual guides that maximised the distance between respective guides.
Generating pooled sgRNA plasmid library using the sgRNA oligonucleotides
The oligo Pools were delivered as a lyophilised product pooled in a single tube with a yield of 76.7ng.
  • Preparation of stock solution of the lyophilised oligo pool:
  • The oligo pool, ordered from Twist bioscience, contained 30 hit genes with 70 oligos at 152bps.
  • Prepare a stock solution of the Oligo Pool by resuspending in 10 mM Tris buffer, pH 8.0 to a concentration of at least 20 ng/µl.
  • Stock solution concentration (ng/ul)=[Total Yield (ng)/ Resuspension volume (ul)]
  • Use the KAPA HiFi HotStart PCR Kit to perform PCR. Since the oligo pool comes under the 2-100 oligos at 151-200nt, it will require 12-14 PCR cycles according to the manufacturer's protocol.
  • Detailed protocol for reconstitution of oligo pool and PCR amplification step can be found in the following link: https://www.twistbioscience.com/sites/default/files/resources/2019-09/Guidelines_OligoPools_%20Amplification_29Aug19_Rev5.1.pdf

The pooled sgRNA mDA Neuron Library was cloned according to the following protocol by Weatheritt Lab Cloning of pooled sgRNAs into lentiviral vector.
Production of lentiviral supernatant
Viral supernatant was produced in accordance with the following protocol:
Citation
Renuka Ravi Gupta, Nona Farbehi, Helaine Graziele Santos Vieira, Helen Elizabeth King, hendersa, Vikram Khurana, Gist Croft, Robert J Weatheritt, Lorenz Studer, Joseph Powell (2026). LENTIVIRAL PRODUCTION FOR PCRISPRi DUAL GUIDE mDA NEURON LIBRARY. protocols.io.
LINK


Titration of lentiviral supernatant
Lentiviral titration was done on H9 dCAS9 CRISPRi cells to determine the amount of virus required for an MOI of 0.1-0.3 (10% - 30% BFP positive cells).
Citation
Renuka Ravi Gupta, Nona Farbehi, hendersa, Vikram Khurana, Gist Croft, Lorenz Studer, Joseph Powell (2026). LENTIVIRAL TITRATION FOR HUMAN PLURIPOTENT STEM CELLS. protocols.io.
LINK

Transduction of H9 dCAS9 CRISPRi
H9 dCAS9 CRISPRi were transduced with the pooled CRISPRi library to obtain the gDNA (genomic DNA) after lentiviral transduction.
Citation
Renuka Ravi Gupta, Nona Farbehi, hendersa, Vikram Khurana, Gist Croft, Lorenz Studer, Joseph Powell (2026). LENTIVIRAL TRANSDUCTION OF HUMAN PLURIPOTENT STEM CELLS. protocols.io.
LINK

sgRNA pool NGS sequencing library preparation
The genomic DNA was sample prepped for Illumina sequencing
Citation
Renuka Ravi Gupta, Helaine Graziele Santos Vieira, Helen Elizabeth King, Nona Farbehi, hendersa, Vikram Khurana, Gist Croft, Robert J Weatheritt, Lorenz Studer, Joseph Powell (2026). gRNA POOL NGS SEQUENCING LIBRARY PREPARATION. protocols.io.
LINK

Protocol references
Replogle, J.M., Norman, T.M., Xu, A. et al. Combinatorial single-cell CRISPR screens by direct guide RNA capture and targeted sequencing. Nat Biotechnol 38, 954–961 (2020). https://doi.org/10.1038/s41587-020-0470-y

Ma, Jian & Köster, Johannes & Qin, Qian & Hu, Shengen & Li, Wei & Chen, Chenhao & Cao, Qingyi & Wang, Jinzeng & Mei, Shenglin & Liu, qi & Xu, Han & Liu, Shirley. (2016). CRISPR-DO for genome-wide CRISPR design and optimization. Bioinformatics. 32. btw476. 10.1093/bioinformatics/btw476. https://bitbucket.org/liulab/crisprdo/src/master/

Replogle JM, Saunders RA, Pogson AN, Hussmann JA, Lenail A, Guna A, Mascibroda L, Wagner EJ, Adelman K, Lithwick-Yanai G, Iremadze N, Oberstrass F, Lipson D, Bonnar JL, Jost M, Norman TM, Weissman JS. Mapping information-rich genotype-phenotype landscapes with genome-scale Perturb-seq. Cell. 2022 Jul 7;185(14):2559-2575.e28. doi: 10.1016/j.cell.2022.05.013. Epub 2022 Jun 9. PMID: 35688146; PMCID: PMC9380471.

McKenna, A., Shendure, J. FlashFry: a fast and flexible tool for large-scale CRISPR target design. BMC Biol 16, 74 (2018). https://doi.org/10.1186/s12915-018-0545-0
Citations
Step  5
Renuka Ravi Gupta, Nona Farbehi, Helaine Graziele Santos Vieira, Helen Elizabeth King, hendersa, Vikram Khurana, Gist Croft, Robert J Weatheritt, Lorenz Studer, Joseph Powell. LENTIVIRAL PRODUCTION FOR PCRISPRi DUAL GUIDE mDA NEURON LIBRARY
https://protocols.io/view/lentiviral-production-for-pcrispri-dual-guide-mda-c9uez6te
Step  6
Renuka Ravi Gupta, Nona Farbehi, hendersa, Vikram Khurana, Gist Croft, Lorenz Studer, Joseph Powell. LENTIVIRAL TITRATION FOR HUMAN PLURIPOTENT STEM CELLS
https://protocols.io/view/lentiviral-titration-for-human-pluripotent-stem-ce-c9wnz7de
Step  7
Renuka Ravi Gupta, Nona Farbehi, hendersa, Vikram Khurana, Gist Croft, Lorenz Studer, Joseph Powell. LENTIVIRAL TRANSDUCTION OF HUMAN PLURIPOTENT STEM CELLS
https://protocols.io/view/lentiviral-transduction-of-human-pluripotent-stem-c9wtz7en
Step  8
Renuka Ravi Gupta, Helaine Graziele Santos Vieira, Helen Elizabeth King, Nona Farbehi, hendersa, Vikram Khurana, Gist Croft, Robert J Weatheritt, Lorenz Studer, Joseph Powell. gRNA POOL NGS SEQUENCING LIBRARY PREPARATION
https://protocols.io/view/grna-pool-ngs-sequencing-library-preparation-c9wgz7bw