Jul 11, 2024

Generating pPB-CAG-mCherry-CAAX Plasmid

  • 1Duke University
Icon indicating open access to content
QR code linking to this content
Protocol CitationShiyi Wang 2024. Generating pPB-CAG-mCherry-CAAX Plasmid. protocols.io https://dx.doi.org/10.17504/protocols.io.4r3l2q34pl1y/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 11, 2024
Last Modified: July 11, 2024
Protocol  Integer ID: 103191
Keywords: ASAPCRN, caax plasmid generating ppb, caax plasmid, generating ppb, plasmid, cag, mcherry
Funders Acknowledgements:
Aligning Science Across Parkinson’s (ASAP) initiative
Grant ID: ASAP-020607
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Generating pPB-CAG-mCherry-CAAX Plasmid
**Obtain Plasmids** - Obtain pPB-CAG-EGFP and pGLAST-PBase plasmids from Dr. Joseph Loturco.
**Insert mCherry-CAAX into pPB-CAG-EGFP** - Insert mCherry-CAAX between XmaI and NotI restriction sites in pPB-CAG-EGFP to replace EGFP.
**Insert hU6 Promoter and shRNA into pPB-CAG-mCherry-CAAX** - Amplify a DNA fragment containing hU6 promoter and shRNA from pLKO.1-shRNA using Phusion High-Fidelity DNA Polymerase with primers introducing SpeI restriction sites: - Forward Primer: GGACTAGTCAGGCCCGAAGGAATAGAAG - Reverse Primer: GGACTAGTGCCAAAGTGGATCTCTGCTG - Purify the PCR products and digest them with SpeI.
**Ligation into pPB-CAG-mCherry-CAAX** - Ligase the purified and SpeI-digested DNA fragment containing hU6 promoter and shRNA into pPB-CAG-mCherry-CAAX at the SpeI restriction site.
**Confirmation by Analytical Digest and Sequencing** - Perform an analytical digest with EcoRI to confirm the correct orientation of the inserted DNA fragment. - Sequence the plasmid to confirm the accurate insertion of hU6 promoter and shRNA sequences.