Icon indicating open access to content
QR code linking to this content
Protocol CitationShiyi Wang 2024. Generating Ezrin Plasmids. protocols.io https://dx.doi.org/10.17504/protocols.io.kqdg32361v25/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 10, 2024
Last Modified: July 10, 2024
Protocol  Integer ID: 103192
Keywords: ASAPCRN
Funders Acknowledgements:
Aligning Science Across Parkinson’s (ASAP) initiative
Grant ID: ASAP-020607
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Generating Ezrin Plasmids
1. pZac2.1-GfaABC1D-BioID2-HA Construction
- **Obtain Materials**
- pZac2.1-GfaABC1D-Lck-GCaMP6f plasmid from Dr. Baljit Khakh (Addgene plasmid #52924).
- pAAV-hSyn-BioID2-Linker-Synapsin1a-HA plasmid for BioID2 sequence.
- **PCR Amplification of BioID2**
- PCR amplify BioID2 sequence from pAAV-hSyn-BioID2-Linker-Synapsin1a-HA using the following primers:
- Forward Primer: 5’-ctagcctcgagaattcaccatgttcaaaaatcttatttg-3’
- Reverse Primer: 5’-ccgggtcgactctagatgcgtaatccggtacatcg-3’
- **Insertion into pZac2.1-GfaABC1D-Lck-GCaMP6f**
- Use In-Fusion cloning (TaKaRa) to insert the PCR-amplified BioID2 sequence into the EcoRI and XbaI restriction sites of pZac2.1-GfaABC1D-Lck-GCaMP6f.
2. pZac2.1-GfaABC1D-Ezrin WT-BioID2-HA and pZac2.1-GfaABC1D-Ezrin T567D-BioID2-HA Construction
- **Obtain Materials**
- pHJ421 (pEGFP-Ezrin WT) and pHJ423 (pEGFP-Ezrin T567D) plasmids from Stephen Shaw (Addgene plasmid #20680 and #20681).
- **PCR Amplification of Ezrin**
- PCR amplify Ezrin sequence from pHJ421 or pHJ423 using the following primers:
- Forward Primer: 5’-ctagcctcgagaattcaccatgccgaaaccaatca-3’
- Reverse Primer: 5’-tgaacatggtgaattccgacagggcctcgaactcg-3’
- **Insertion into pZac2.1-GfaABC1D-BioID2**
- Insert the PCR-amplified Ezrin sequence into the EcoRI restriction sites of pZac2.1-GfaABC1D-BioID2 for both Ezrin WT and Ezrin T567D variants.
3. pZac2.1-GfaABC1D-Ezrin T567A-BioID2-HA Construction
- **Mutagenesis**
- Use the Q5® Site-Directed Mutagenesis Kit (NEB) to generate the Ezrin T567A mutation in pZac2.1-GfaABC1D-Ezrin T567D-BioID2-HA.
- Perform mutagenesis using the following mutagenesis primers:
- Forward Primer: CAAGTACAAGGCGCTGCGGCAGA
- Reverse Primer: TCCCGGCCTTGCCTCATG
- **Confirmation**
- Verify the presence of the Ezrin T567A mutation in the plasmid through sequencing or restriction digest analysis.
Notes:
- Ensure proper sterile technique and use of appropriate safety precautions during handling of plasmids and reagents.
- Perform all steps under sterile conditions to avoid contamination.
- Validate all constructs through sequencing to confirm the correct insertion or mutation.