Feb 02, 2026
Version 3
Generating Ct cut-off values using gBlocks gene fragments V.3
- 1Imperial College London, UK;
- 2Imperial College London;
- 3CMC Vellore
- Typhoid Environmental Surveillance
Protocol Citation: Jonathan Rigby, Catherine Troman, Jaspreet Mahindroo, Alex Shaw, Dilip Abraham, Nick Grassly 2026. Generating Ct cut-off values using gBlocks gene fragments. protocols.io https://dx.doi.org/10.17504/protocols.io.n2bvj8kr5gk5/v3Version created by Jonathan Rigby
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 16, 2025
Last Modified: February 02, 2026
Protocol Integer ID: 235158
Keywords: Salmonella, Typhi, Paratyphi, wastewater, environmental surveillance, qpcr of gblocks gene fragment, gblocks gene fragment, using gblocks gene, gblocks gene, rrna gene, generating ct, stranded dna oligo, gblock, dna oligo, triplex qpcr, stranded dna, dna, qpcr, hf183 bacteroides rrna gene, hf183 bacteroide
Funders Acknowledgements:
Bill and Melinda Gates Foundation
Abstract
The following protocol describes the resuspension, dilution, and qPCR of gBlocks gene fragments. gBlocks gene fragments are synthesised double stranded DNA oligos, which can be used for standardisation.
In this protocol, the standard curves generated by the gBlocks in a triplex qPCR are used to determine a Ct cut-off value for the S. Typhi gene targets (ttr, tviB, staG, C6) and the HF183 Bacteroides rRNA gene.
Materials
TE Buffer
gBlocks gene fragments (see protocol)
Takyon Low ROX Probe 2x MasterMix dTTP blueEurogentecCatalog #UF-LPMT-B0701
Nuclease free water
qPCR DNA Extraction and Inhibition Control CY5-QXL670EurogentecCatalog #RT-SPCC-Q02
gBlocks details
gBlocks gene fragments are synthesised double stranded DNA fragments which contain the sequence for the amplicon of interest, in this case for ttr, staG, tviB and C6 in S. Typhi, and HF183 in Bacteroides.
| A | B | C | |
| Gene target | Size (bp) | gBlock sequence (5' - 3') | |
| ttr | 125 | GAAACGCTGAACGGACTCACCAGGAGATTACAACATGGCTAATTTAACCCGTCGTCAGTGGCTAAAAGTCGGTCTCGCCGTCGGTGGGATGGTCACTTTTGGTCTGAGCTACCGTGATGTGGCGA | |
| staG | 138 | CGGCGCGAAGTCAGAGTCGACATAGGCATAGATTTTCAGGCCATACATTAATTTGCCAAGGTTGCTATAAACATTTGTTCTGGAGCAGGCTGACGGAAATTCCGTGAACTCGCTGGTGATCGGCGTTGAGGTCTTATC | |
| tviB | 125 | CTTGATTTGACTTCCGATACCGGGATAATGCCATACTCTCGTCTTACCTCTTCGGCATCCACCCATGGATCAAAAATATCCACTTTACAACTATATTTACCGAGTTCCTTTACCACATCAATAAT | |
| C6 | 125 | AGTCCGATACGCGATGTAATTTATCTCACGGAAATAGGTACGTTTATCGCGCGGCGCATCAATCAGGCTTTCTCGCGGGATGCCAGTTCCGTCAAATATCGCGATGAATCTCACTTTGCAGATTC | |
| HF183 | 132 | GGGATCATGAGTTCACATGTCCGCATGATTAAAGGTATTTTCCGGTAGACGATGGGGATGCGTTCCATTAGATAGTAGGCGGGGTAACGGCCCACCTAGTCAACGATGGATAGGGGTTCTGAGAGGAAGGTC |
Table 1: Sequences for gBlocks gene fragments for S. Typhi gene targets and HF183.
IDT's gBlocks must be a minimum of 125 bases long. Other brands may have different length requirements.
Resuspending and diluting the gBlocks
gBlocks are supplied as a lyophilised pellet and must be resuspended. To ensure the best recovery of product, the following steps are recommended from the manufacturer:
For this protocol, a solution of 10 ng/µL is required.
Information on the ng provided lyophilised, OD260, and molecular weight are given on the spec sheet provided with the gBlocks.
The following online tools can be used to assist in these calculations:
Centrifuge the Lyophilised gBlock for 3-5 seconds before opening
Resuspend in molecular-grade nuclease-free water or 1x TE Buffer to reach the concentration of 10 ng/µL
- Example, if the gBlock states 250 ng , add 25 µL of solvent
Vortex for 3-5 seconds
Incubate at 50 °C for 15-20 minutes
Vortex for 3-5 seconds and then centrifuge for 3-5 seconds, allowing to cool before opening the tube.
Once resuspended, check the concentration via Qubit or Nanodrop.
If possible, dilute to 10 ng/µL for storage; if below this already, normalise to 1 ng/µL , the first concentration for the serial dilution below.
- Note - gBlocks stored at a concentration of <1 ng/µL , loss of material may occur over time due to adherence to the plastic tube
- To minimise loss, add tRNA or Poly A to storage stock, at a final concentration of 0.1 mg/mL to 1 mg/mL in the dilution.
Note - gBlock stored at a concentration of
Create serial dilutions of your stock solution adding 2 µL of stock into 18 µL of nuclease-free water. We recommend carrying out 12 dilutions to create a series of 12 concentrations starting at 1 ng/µL .
- Each dilution will have a final volume of 18 µL , this is sufficient for 3 replicates with some room for pipetting error.
- We recommend at least 10 replicates split over at least two days. The more replicates, the more accurate the Probit calculation will be for Ct value cut-offs.
- Aliquot the dilution stocks into usable quantities, so they may be stored for use without needing to freeze-thaw larger volumes.
For example, performing four replicates of 12 dilutions three times on three separate days. This would be two plates each day to include all targets.
Figure 1: Example plate map for evaluation qPCR set up for Ct Value Cut-Off calculations.
Note: in this configuration ttr and HF183 will only have 9 replicates.
qPCR and generating a standard curve
Prepare the triplex qPCR mastermix described below (or singleplex for HF183)
| A | B | C | |
| Reagent | Volume per reaction (uL) | Final Concentration (uM) | |
| tviB_F | 0.5 | 0.4 | |
| tviB_R | 0.5 | 0.4 | |
| tviB_Pr | 1 | 0.2 | |
| staG_F | 0.5 | 0.4 | |
| staG_R | 0.5 | 0.4 | |
| staG_Pr | 1 | 0.2 | |
| C6_F | 0.5 | 0.4 | |
| C6_R | 0.5 | 0.4 | |
| C6_Pr | 1 | 0.2 | |
| 2x MasterMix with ROX | 12.5 | 1x | |
| Nuclease-free water | 1.5 | - |
Table 2: Mastermix composition for the S. Typhi Triplex qPCR
| A | B | C | |
| Reagent | Volume per reaction (uL) | Final Concentration (uM) | |
| ttr_F | 0.5 | 0.4 | |
| ttr_R | 0.5 | 0.4 | |
| ttr_Pr | 1 | 0.2 | |
| HF183_F | 0.5 | 0.4 | |
| HF183_R | 0.5 | 0.4 | |
| HF183_Pr | 1 | 0.2 | |
| 2x MasterMix with ROX | 12.5 | 1x | |
| 10x Control mix (Eurogentec) | 2.5 | 1x | |
| Nuclease-free water | 1 | - |
Table 3: Mastermix composition for the Control Triplex qPCR
Aliquot 20 µL of master mix for each reaction in a 96-well plate. Add 5 µL of gBlock dilution to each reaction.
Ensure that although the reaction is designed as a triplex, you only put one target gBlock in each reaction.
Seal the plate carefully then spin down briefly to gather all reagents at the bottom of the wells and remove bubbles.
Load the plate into the real-time PCR machine after setting it up appropriately and carry out cycling using the following conditions:
| A | B | C | |
| Cycle | Temperature (C) | Duration | |
| 1 | 50 | 2 minutes | |
| 1 | 95 | 2 minutes | |
| 40 | 95 | 15 seconds | |
| 60 | 30 seconds | ||
| 72 | 30 seconds |
Table4: Cycling conditions for all qPCR reactions.
Analysis - determining Ct cut-off
The limit of detection (LOD_95) is the genome copy number/µL (- GC/µL ) and associated Ct value at which a qPCR amplification would be observed 95% of the time. This can be calculated from the results of the dilution series using PROBIT analysis.
We have provided an Excel file to calculate the LOD_95 for you from your data (resource:
LOD calculation Version 3.xlsm35.4KB ). Make sure you allow macros to be run. You will also need to enable the Microsoft Solver add-in. Instructions for doing so are here.
LOD calculation Version 3.xlsm35.4KB ). Make sure you allow macros to be run. You will also need to enable the Microsoft Solver add-in. Instructions for doing so are here.Alternatively you can use the statistical programming language R to fit the PROBIT curve. Example code:
#fit the profit curve
mod=glm(Ct_bin ~ log_conc, data=subset(gblocks, target=="ttr"), family=binomial(link="probit"))
summary(mod)
#calculate the LOD_95 in log concentration (GC/uL)
LOD_est_ttr=(qnorm(0.95)-mod$coefficients[1])/mod$coefficients[2]
#predict the LOD_95 Ct and range
LOD_Ct_ttr=predict(lm(Ct ~ log_conc, data=subset(gblocks, target=="ttr")), newdata=list(log_conc=LOD_est_ttr), interval="prediction")
To calculate the GC/µL from the qPCR Ct values of actual samples you can use the equation:
log GC/µL = (Ct – intercept) / slope
where slope and intercept are from the linear regression of the Ct value on log GC/µL generated from the standard curves (e.g. as given in the Excel spreadsheet or from the linear model (lm) fit in R).