Oct 02, 2023

Gene editing of YIPF3, YIPF4, CALCOCO1, FIP200, and ATG7 in HEK293 and HeLa cells V2

Forked from a private protocol
  • 1Harvard Medical School
Icon indicating open access to content
QR code linking to this content
Protocol CitationHarper JW, Kelsey Hickey, sharan_swarup 2023. Gene editing of YIPF3, YIPF4, CALCOCO1, FIP200, and ATG7 in HEK293 and HeLa cells V2. protocols.io https://dx.doi.org/10.17504/protocols.io.6qpvr3462vmk/v1
Manuscript citation:
https://www.biorxiv.org/content/10.1101/2022.12.06.519342v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 03, 2023
Last Modified: May 31, 2024
Protocol  Integer ID: 85934
Keywords: ASAPCRN, gene editing of yipf3, atg7 knockout cell lines in hek293, gene editing, using crispr, crispr, hela cells v2 this protocol, atg7 in hek293, atg7 knockout cell line, hela cells v2, hela cell, hek293, cas9, creation of yipf3, calcoco1, atg7, yipf4, cell, yipf3, cell line
Funders Acknowledgements:
ASAP
Grant ID: 000282
Abstract
This protocol describes the creation of YIPF3, YIPF4, FIP200, CALCOCO1, and ATG7 knockout cell lines in HEK293 and HeLa cells using CRISPR-Cas9.
Materials
Puromycin (Gold Biotechnology, P-600-100) pX459 (Addgene #62988)
HEK293 (ATCC CRL-1573, RRID: CVCL_0045 )
anti-YIPF4 (Sino Biological 202844-T46)
anti-ATG7 (Cell Signaling Technology, 8558S) anti-CALCOCO1 (Abclonal A7987)
Dulbecco’s MEM (DMEM), high glucose, pyruvate (Gibco / Invitrogen, 11995)
Cell line maintenance
Maintain HEK293 and/or HeLa cells in Dulbecco’ Modifies Eagles Medium (DMEM) with 10% fetal bovine serum and optional 1% penicillin-streptomycin.
Targeted knock-out specific genes including YIPF3, YIPF4, CALCOCO1, FIP200, or ATG7: targeting vector creation
For YIPF4 knock-out, the following sgRNA sequences were designed and ordered (5’ ATCTCGCGGCGACTCCCAAC 3' / 5’ CGGCCTATGCCCCCACTAAC 3' ), and cloned into a pX459 vector to create pX459-gRNA-YIPF4-KO.

For CALCOCO1 knock-out, the following sgRNA sequences were designed and ordered (5’ AAGTTGACTCCACCACGGGA 3' / 5’ CTAAGCCGGGCACCATCCCG 3'), and cloned into a pX459 vector to create pX459-gRNA-CALCOCO1-KO.

For ATG7 knock-out, the following sgRNA sequence was designed and ordered (5’ ATCCAAGGCACTACTAAAAG 3'), and cloned into a pX459 vector to create pX459-gRNA-ATG7-KO.

For FIP200 knock-out, the following sgRNA sequence was designed and ordered (5’ ACTACGATTGACACTAAAGA 3'), and cloned into a pX459 vector to create pX459-gRNA-FIP200-KO.

For YIPF3 knock-out, the following sgRNA sequences were designed and ordered (5’ CCATTTCGGGCGCCGCCCGC 3' / 5’ GGCGGCGCCCGAAATGGAGC 3'), and cloned into a pX459 vector to create pX459-gRNA-YIPF3-KO.

Sequence validate by Sanger sequencing.
CRISPR editing and confirmation
Transfect HEK293 and/or HeLa cells with the pX459-gRNA-YIPF4-KO, pX459-gRNA-CALCOCO1-KO, pX459-gRNA-ATG7-KO, gRNA-FIP200-KO, or gRNA-YIPF3-KO with Lipofectamine 3000, and select with 1.2 µg/mL of puromycin for 24-48 hours. Select monoclonal cells by limiting dilution or by cell sorting (SONY SH800S sorter) in 96 well plates.
Individual clones were subjected to immunoblotting with anti-YIPF4 (Sino Biological 202844-T46), anti-ATG7 (Cell Signaling Technology, 8558S), anti-FIP200 (Cell Signaling Technology, 12436), anti-YIPF3 (Invitrogen PA566621), or anti-CALCOCO1 Rabbit mAb antibody (Abclonal A7987) and clones lacking the relevant protein were selected for further analysis by Sanger sequencing of the edited alleles.