Mar 24, 2025

Fungal Isolation and Cell DNA (c-DNA) Extraction from Soil Samples

Fungal Isolation and Cell DNA (c-DNA) Extraction from Soil Samples
  • Nuttapon Pombubpa1,2,
  • Ariya Chindamporn3,2,
  • Nattapol Kraisitudomsook4,2,
  • Neil Andrew Robert Gow5,2,
  • Syahriar Nur Maulana Malik Ibrahim1,2,
  • Fikran Aranda Fahrudin6,2
  • 1Department of Microbiology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand;
  • 2Southeast Asia Antifungal Resistance Monitoring Initiative (SEA-ARMi), Department of Microbiology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand;
  • 3Department of Microbiology, Faculty of Medicine, Chulalongkorn University, Bangkok 10330, Thailand;
  • 4Department of Biology, Faculty of Science and Technology, Muban Chombueng Rajabhat University, Ratchaburi 70150, Thailand;
  • 5Medical Research Council Centre for Medical Mycology, University of Exeter, Exeter, United Kingdom;
  • 6Program of Biotechnology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand
Icon indicating open access to content
QR code linking to this content
Protocol CitationNuttapon Pombubpa, Ariya Chindamporn, Nattapol Kraisitudomsook, Neil Andrew Robert Gow, Syahriar Nur Maulana Malik Ibrahim, Fikran Aranda Fahrudin 2025. Fungal Isolation and Cell DNA (c-DNA) Extraction from Soil Samples. protocols.io https://dx.doi.org/10.17504/protocols.io.3byl4w1krvo5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: January 30, 2025
Last Modified: March 24, 2025
Protocol Integer ID: 119317
Keywords: Fungal isolation, WHO FPPL, Fungal genome extraction, Fungal identification, Soil fungal, accurate responses to fungal threat, extracting fungal genomic dna, resistant fungi, fungal genomic dna, fungal pathogen, antifungal resistance, fungal threat, several pathogenic fungi, antifungal resistance to major drug class, fungi, fungal isolation, agricultural biosecurity, strategies against fungal infection, fungal infection, including fungi, including fusarium group, fusarium group, leveraging genomic technology, specific resistance gene, diverse microorganism, comprehensive genome database, genomic technology, agricultural soil, dna extraction, collecting soil sample, prevalent in thailand, eumycetoma agent, soil samples soil, genomic dna, soil sample, extraction from soil samples soil, significant human infection, caused significant human infection, network of mycologist, soil, humans through infection
Funders Acknowledgements:
FAILSAFE Awarded projects - Seed Grant
Grant ID: FAILSAFE FR1-23
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Soil harbors diverse microorganisms, including fungi that play crucial environmental roles but can also harm plants, animals, and humans through infections or spore exposure. In 2022, the WHO released several pathogenic fungi, including Fusarium group, Mucorales and Eumycetoma agents, which are prevalent in Thailand's agricultural soils and have caused significant human infections. Despite this, the genetic mechanisms behind their infections and antifungal resistance remain poorly understood, particularly in Southeast Asia. Antifungal resistance to major drug classes, such as azoles, echinocandins, and polyenes, is increasing, driven by specific resistance genes. To address these challenges, we propose establishing a Southeast Asian (SEA) network of mycologists to study fungal pathogens, focusing on collecting soil samples, extracting fungal genomic DNA, and creating a comprehensive genome database. This initiative will improve detection and management of drug-resistant fungi, enhance clinical treatments, and strengthen agricultural biosecurity. By leveraging genomic technologies and fostering international collaboration, the project aims to develop targeted strategies against fungal infections and resistance, benefiting public health, food security, and sustainable agriculture across SEA. Establishing a fungal biobank and expert network will support long-term efforts to combat antifungal resistance, providing critical resources for swift and accurate responses to fungal threats.
Materials
Molecular process
  • AllPrep Fungal DNA Kit (QIAGEN)
  • Agarose and Electrophoresis Set
  • TBE Buffer
  • DNA Ladder
  • PCR master mix with Mg2+, dNTPs, and Taq DNA polymerase 
  • ITS1 and ITS4 primer set

Isolation process
  • Sterile Water, for dilution (10-3 to 10⁻6)
  • Spread Rod, for cultivation
  • Petri Dish
  • Glass Rod, for spread plate cultivation
  • V-rod glass or steel, for slide culture
  • Object and Cover Glasses
Culture Media:
  • Potato Dextrose Agar (PDA)
  • Potato Dextrose Broth (PDB)
  • Malt Extract Agar (MEA)
  • Antibacteria (Tetracyclin 40 mg/L)

Fungal Isolation
Sample Preparation
Weigh 1 g of soil sample.

Perform serial dilutions of soil using sterile water (10⁻³ to 10⁻⁶ dilutions with 9 mL sterile water).
Cultivation Using Spread Plate Method
Spread 100 µL of each dilution onto culture media (PDA and MEA) that contains antibacteria (tetracyclin 40 mg/L).
Incubate plates at room temperature (25-30 ºC) for 5–7 days until fungal colonies are visible.
Colony Purification
Transfer fungal hyphae from mixed colonies to fresh PDA plates for purification.
Incubate at room temperature (25-30 ºC) for 5–7 days to obtain pure colonies.
*Note: Repeat this step until a single culture is obtained.
Fungal Identification
Colony morphology and microscopic documentation

The colony features based on:
  • Color (top and reverse)
  • Margin (smooth/entire, filamentous, lobed, or irregular)
  • Elevation (flat, raised, umbonate (with a central bump), or wrinkled)
  • Texture (powdery, velvety, cottony, granular, glabrous, or creamy)
  • Zonation (presence or not)
  • Radial furrow (presence or not)
  • Exudate drop (presence or not)

The microscopic can be prepared by slide culture technique
Prepare slide cultures to observe substrate and aerial hyphal structures. Adding Lactophenol-Cotton Blue stain to the growth colony is recommended for better visualization.
Characterize the cell structure based on:
  • Hyphae (septate or aseptate)
  • Spore - Asexual (consisting of macroconidium, microconidium, chlamydospore, arthrospore, blastospore, or sporangiospore)
  • Spore - Sexual (type of ascospore, basidiospore, or zygospore)
  • Sporangiophore (consisting of aporangium, columella, or hyphae-stalk)
  • Conidiophore (type of simple, complex, acrotheca, cladosporium or phialophora)

*Read the technique of slide culture here: https://sea-armi.github.io/research/SlideCulture
Fungal identity confirmation

Compare the colony and slide culture results with fungal book determination.
Reference:
  • Barnett & Hunter, 1998. Illustrated Genera of Imperfect Fungi, Fourth Edition
  • SEA-ARMi, 2025. Filamentous WHO FPPL target: Mucorales, Eumycetoma causative agents, and Fusarium group

*Read the Barnett & Hunter, 1998. Illustrated Genera of Imperfect Fungi, Fourth Edition at the attached file
*Read SEA-ARMi, 2025. targeted filamentous WHO-FPPL here: https://sea-armi.github.io/research/TargetedWHO
Molecular identification

For molecular identification, single fungal colony DNA extraction follows Step 7 (cDNA extraction).
The fungal genome is amplified using the Internal Transcribed Spacer (ITS) region, with the following primers:
  • ITS1 forward primer: 5' TCCGTAGGTGAACCTGCGG 3'
  • ITS4 reverse primer: 5' TCCTCCGCTTATTGATATGC 3'
These primers are used to amplify conserved regions of fungal DNA (White et al., 1990).

PCR Mixture (25 µL total volume):
  • 12.5 µL PCR master mix with Taq DNA polymerase
  • 0.5 µL forward primer
  • 0.5 µL reverse primer
  • 12 µL solution (DNA template diluted with molecular-grade water, ensuring a final DNA concentration of 100 ng)

The negative control is PCR mixture without DNA template and the positive control is identified fungal.
Citation
White, T. J., Bruns, T., Lee, S. J. W. T., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications.
LINK

The PCR conditions for amplifying ITS were as follows:
Initial denaturation step at 95°C for 5 minutes
25 cycles of
  • 1 minute at 95°C
  • 25 seconds at 56°C
  • 30 seconds at 72°C
with a final extension at 72°C for 5 minutes
Holding the PCR product at 4°C.
The PCR product is analyzed using 1.5% agarose gel electrophoresis, with a 1 Kb DNA ladder as a size marker. Electrophoresis is performed at 100V for 22 minutes in 1× TBE buffer.
High-quality PCR products will be sequenced using Sanger sequencing, and the resulting sequence files will be identified using BLAST (NCBI database).
The pure identified colony can be used for the cDNA extraction.
cDNA Extraction
Inoculate the pure fungal colony to PDB and incubate for 5 days to get enough hyphae at room temperature (25-30 ºC) with 100 rpm.
Use the AllPrep Fungal DNA Kit to extract DNA from the cell hyphae.
Prepare fungal cell samples and resuspend in Solution HC.
Perform cell lysis with vortexing.
Load lysate into MB Spin Columns.
Wash columns with Solutions RA and RW.
Elute DNA with Solution EB.
DNA Qualification and Quantification
Perform agarose gel electrophoresis to verify DNA quality and purity.
Use a Nanodrop spectrophotometer to quantify DNA concentration and purity (at least 10 ng/µL).
Submission of Isolated DNA
Send the purified fungal DNA to the FAILSAFE Project Team, SEA-ARMi at Chulalongkorn University for further analysis.

Citations
Step 5
White, T. J., Bruns, T., Lee, S. J. W. T., & Taylor, J.. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics
https://www.researchgate.net/publication/223397588_White_T_J_T_D_Bruns_S_B_Lee_and_J_W_Taylor_Amplification_and_direct_sequencin