Oct 06, 2023
- czc 1
- 1BGI Genomics
Protocol Citation: czc 2023. FLOUR-seq. protocols.io https://dx.doi.org/10.17504/protocols.io.yxmvmnpm6g3p/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 26, 2022
Last Modified: October 06, 2023
Protocol Integer ID: 61436
Keywords: rna panorama, rna, length rna, degrading rna, ultralong three barcode, sequencing, barcoded technology, barcode, using nanopore technology, nanopore technology, cell ont
Abstract
We presented three barcoded technologies (BD Rhapsody) that are accessible to most researchers: high-throughput single-cell ONT full-length RNA sequencing (FLOUR-seq). FLOUR-seq combines BD Rhapsody and nanopore sequencing to detect the RNA panorama (including nascent, mature, and degrading RNAs) in cells.The ultralong three barcodes can be discriminated using nanopore technology with 70% debarcoding efficiency and can detect the RNA panorama.
Troubleshooting
mouse testis cell dissociation
1d
The mouse testis were dissociated to single cells refer to Adult mouse testis cell dissociation (on ice).
1d
Priming and treating the BD Rhapsody Cartridge
20m
Prime and treat the BD Rhapsody Cartridge (Cat. No. 400000847).
| A | B | C | D | E | |
| Step | Regent to load | Volume (μL) | P1200M pipette mode | Incubation at room temp. | |
| 1 | 100% ethyl alcohol | 700 | Prime/Treat | - | |
| 2 | Air | 700 | Prime/Treat | - | |
| 3 | Room temp. Cartridge Wash Buffer 1 (Cat. No. 650000060) | 700 | Prime/Treat | 1min | |
| 4 | Air | 700 | Prime/Treat | - | |
| 5 | Room temp. Cartridge Wash Buffer 1 (Cat. No. 650000060) | 700 | Prime/Treat | 10min | |
| 6 | Air | 700 | Prime/Treat | - | |
| 7 | Room temp. Cartridge Wash Buffer 2 (Cat. No. 650000061) | 700 | Prime/Treat | <4h |
20m
Loading cells in cartridge
22m
Dilute 20000 cells with cold Sample Buffer (Cat. No. 650000062) to 650 μL.
5m
Load cartridge with materials listed using the P1200M pipette:
| A | B | C | |
| Material to load | Volume (μL) | Pipette mode | |
| Air | 700 | Prime/Treat | |
| Set P1200M pipette to Cell Load mode. Pipet-mix the cell suspension with a manual P1000 pipette. | |||
| Cell suspension | 575 | Cell Load | |
2m
Incubate at room temperature (15°C to 25°C) for 15 minutes. During 15 minute incubation, prepare Cell Capture Beads(Cat. No. 650000089).
15m
Preparing, loading and washing Cell Capture Beads
12m
Place Cell Capture Bead tube on magnet for 1 minute, and remove storage buffer.
Remove tube from magnet, and pipet 650 μL cold Sample Buffer (Cat. No. 650000062) into tube.
2m
Set P1200M pipette to Prime/Treatmode. Load cartridge with materials listed using the P1200M pipette:
| A | B | C | |
| Material to load | Volume (μL) | Pipette mode | |
| Air | 700 | Prime/Treat | |
| Set P1200M pipette to Bead Load mode. Use a manual P1000 to gently pipet-mix beads in cold Sample Buffer (Cat. No. 650000062). Immediately load. | |||
| Cell Capture Beads | 630 | Bead Load | |
1m
Incubate the cartridge at room temperature (15°C to 25°C) for 3 minutes.
3m
Place cartridge on the plate shaker plate adapter. Shake the cartridge at room temperature (15°C to 25°C) at 1,000 rpm for 15 seconds.
Return cartridge to Express instrument, and wait 30 seconds.
1m
Set P1200M pipette to Wash mode. Load cartridge with materials listed using the P1200M pipette:
| A | B | C | |
| Material to load | Volume (μL) | Pipette modea | |
| Air | 700 | Wash | |
| Cold Sample Buffer (Cat. No. 650000062) | 700 | Wash | |
| Air | 700 | Wash | |
| Cold Sample Buffer (Cat. No. 650000062) | 700 | Wash |
5m
Lysing cells
7m
Add 75.0 μL 1 M DTT (Cat. No. 650000063) to one 15 mL Lysis Buffer bottle (Cat. No. 650000064). Briefly vortex lysis mix, place on ice.
2m
Move the left slider to LYSIS on Express instrument. Set P1200M pipette to Lysis mode. Set P1200M pipette to Lysis mode.
| A | B | C | |
| Material to load | Volume (μL) | Pipette mode | |
| Lysis Buffer with DTT | 550 | Lysis |
Incubate at room temperature (15°C to 25°C) for 2 minutes.
5m
Retrieving Cell Capture Beads
9m
Place the 5 mL LoBind Tube in Express instrument drawer. Ensure P5000M pipette is set to Retrieval mode. Move the front slider to BEADS on Express instrument.
2m
Move the left slider to RETRIEVAL. Leave Retrieval magnet in down position for 30 seconds. Aspirate 5,000 μL Lysis Buffer with DTT with the P5000M pipette. Press down on P5000M pipette to seal against the gasket. Move the left slider to the middle position (0), andimmediatelyload 4,950 μL Lysis Buffer with DTT.
5m
Remove pipette from gasket, and purge tip. Move the front slider to OPEN, and place the 5 mL LoBind Tube on large magnet with 15 mL tube adapter (V&P Scientific Cat. No. VP 772FB-1A) for 1 minute.
2m
Washing Cell Capture Beads
8m
After 1 minute incubation leaving the 5 mL tube containing retrieved Cell Capture Beads on large magnet, remove all but ~1 mL of supernatant without disturbing beads.
1m
Remove tube from magnet. Gently pipet-mix beads, and transfer them to a new 1.5 mL LoBind Tube.
1m
Place tube on magnet for ≤2 minutes, and remove supernatant. Avoid leaving Lysis Buffer or bubbles in tube. Lysis Buffer might cause the reverse transcription reaction to fail.
2m
Remove tube from magnet and pipet 1.0 mL of cold Bead Wash Buffer (Cat. No. 650000065) into tube. Pipet-mix.
1m
Place tube on 1.5 mL tube magnet for ≤2 minutes, and remove supernatant.
2m
Remove tube from magnet, and pipet 1.0 mL cold Bead Wash Buffer (Cat. No. 650000065) into tube. Pipet-mix, and place on ice.
1m
cDNA synthesis and template switching
1h 39m
In a new 1.5-mL LoBind tube, pipet the following reagents.
cDNA/Template switching mix
| A | B | |
| Component | Volume (μL) | |
| RT Buffer | 40 | |
| dNTP | 20 | |
| RT 0.1 M DTT | 10 | |
| Bead RT/PCR Enhancer | 12 | |
| RNase Inhibitor | 10 | |
| Reverse Transcriptase | 10 | |
| Nuclease-free water | 92 | |
| Total | 194 |
Gently vortex mix, briefly centrifuge, and place back on ice.
10m
Place the tube of washed Cell Capture Beads on a 1.5-mL tube magnet for≥2 minutes. Remove the
supernatant and pipet 194 μL of cDNA mix into the beads. Pipet-mix.
5m
Incubate the bead suspension on the thermomixer at 1,200 rpm and 42°C for 30 minutes.
30m
Place tube on 1.5 mL tube magnet for ≤2 minutes, and pipet supernatant to a new tube. Remove tube from magnet, and pipet 200 μL the following reagents into tube.
| A | B | |
| Component | Volume (μL) | |
| 10x Exonuclease I reaction buffer (BD Express, Cat. No. 650000071) | 20 | |
| Exonuclease I (BD Express, Cat. No. 650000072) | 10 | |
| Nuclease-free water | 170 |
5m
Place tube on 1.5 mL tube magnet for ≤2 minutes, and remove supernatant. Wash the beads twice with 1x RT buffer.
10m
Resuspend the beads with the saved supernatant in step 25, add 3 μL of template switch oligo (100 uM5' A AGC AGT GGT ATC AAC GCA GAG TAC rG rG +G 3') , and incubate on the thermomixer for 15 minutes at 1,200 rpm and 42°C. Add 2 μL of 1 M MgCl2 to the reaction mix, and incubate on the thermomixer for another 15 minutes at 1,200 rpm and 42°C.
35m
Briefly spin the tube with the bead suspension. Place the tube on the magnet for≤1 minute until clear. Remove the supernatant.
2m
Remove the tube from the magnet, and pipet 200 μL of cold Bead Resuspension Buffer into the tube. Pipet- mix.
2m
Performing PCR1
2h 14m
Place the tube beads in Bead Resuspension Buffer on a 1.5-mL magnet for≤1 minute. Remove the supernatant. Suspend the beads with following PCR reaction mix:
| A | B | C | |
| Component | Volume (μl ) | Final Conc | |
| KAPA HiFi HotStart 2x ReadyMix | 100 | 1x | |
| Universal Oligo (BD Express, 650000074) | 6 | 0.3 μM | |
| TSO PCR primer (10μM) | 6 | 0.3μM | |
| Nuclease-free water | up to 200μl |
Universal Oligo: 5’-ACACGACGCTCTTCCGATCT-3'
TSO PCR primer: 5‘-AAGCAGTGGTATCAACGCAGAGTAC-3'
10m
Ensuring that the beads are fully resuspended, pipet 25 μL of PCR reaction mix with beads into each of 8 0.2-mL PCR tubes.
2m
Program the thermal cycler as follows.
| A | B | C | D | |
| Step | Cycles | Temperature | Time | |
| Hot start | 1 | 95°C | 3 min | |
| Denaturation | 11 | 98°C | 20 s | |
| Annealing | 62°C | 3 min | ||
| Extension | 72°C | 4 min | ||
| Final extension | 1 | 72°C | 2 min | |
| Hold | 1 | 4°C | ∞ |
1h 30m
Pipet-mix and combine the four reactions into a new 1.5-mL LoBind tube. Place the 1.5-mL tube on the magnet for≤1 minute. Pipet the supernatant into the new 1.5-mL LoBind tube without disturbing the beads.
2m
Purify the amplified products by 0.7x Agencourt AMPure XP Beads(Beckman Coulter).
30m
Performing PCR2
1h 10m
Prepare the PCR mix by combining and mixing the following components:
| A | B | C | |
| Component | Volume (μl ) | Final Conc | |
| KAPA HiFi HotStart 2x ReadyMix | 500 | 1x | |
| Library Forward Primer (BD Express,91-1085) | 3 | 0.3 μM | |
| TSO lengthen primer (10μM) | 3 | 0.3μM | |
| PCR1 product (50ng) | |||
| Nuclease-free water | up to 100μl |
TSO lengthen primer: 5'-CGACATGGCTACGATCCGACAAGCAGTGGTATCAACGCAGAG-3'
Library Forward primer: 5'- AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
10m
Program the thermal cycler as follows.
| A | B | C | D | |
| Step | Cycles | Temperature | Time | |
| Hot start | 1 | 95°C | 2 min | |
| Denaturation | 5 | 98°C | 20 s | |
| Annealing | 62°C | 20 s | ||
| Extension | 72°C | 4 min | ||
| Final extension | 1 | 72°C | 2 min | |
| Hold | 1 | 4°C | ∞ |
30m
Purify the amplified products by 0.7x Agencourt AMPure XP Beads(Beckman Coulter).
30m
Nanopore sequencing
3d
Prepared sequencing using Oxford Nanopore Technologies SQK-LSK109 and sequenced on ONT PromethION platforms.
3d