Jun 05, 2025

Flag-TBK1 N455S and Flag-TBK1 M559R cloning (NEB Site directed mutagenesis kit, #E0554S)

DOI
https://dx.doi.org/10.17504/protocols.io.81wgbzynogpk/v1
  • 1NIMH
Christopher Bartley
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.81wgbzynogpk/v1
Protocol Citation: Jailyn Izu 2025. Flag-TBK1 N455S and Flag-TBK1 M559R cloning (NEB Site directed mutagenesis kit, #E0554S). protocols.io https://dx.doi.org/10.17504/protocols.io.81wgbzynogpk/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 16, 2024
Last Modified: March 27, 2026
Protocol  Integer ID: 99881
Keywords: mutagenesis of tbk1, tbk1 m559r cloning, mutagenesis kit, directed mutagenesi, tbk1 n455, cloning, tbk1
Funders Acknowledgements:
National Institute of Mental Health
Grant ID: ZIA MH002982
National Institute of Mental Health
Grant ID: R01MH122471
National Institute of Neurological Disorders and Stroke
Grant ID: U01NS120836
Foundation for the National Institutes of Health
Grant ID: Deeda Blair Research Initiative for Disorders of the Brain
Abstract
site-directed mutagenesis of TBK1 variant vectors
Materials
  • Template DNA: TBK1 expression plasmids (OmicsLink‱ Expression Clone EX-U0617-M09/EX-U0617-M11; GeneCopoeia, Inc., Rockville, MD)
  • Flag-tagged EGFP expression plasmid (OmicsLink‱ Expression Clone EX-EGFP-M11; GeneCopoeia, Inc., Rockville, MD), will not go through mutagenesis
  • HA-tagged EGFP expression plasmid (OmicsLink‱ Expression Clone EX-EGFP-M09; GeneCopoeia, Inc., Rockville, MD), will not go through mutagenesis
  • Q5® Site-Directed Mutagenesis Kit (NEB, #E0554S)
  • Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs, #M0494S)
  • Forward and reverse primers:

TBK1-N455S mutation:
Forward Primer: GATGATTACAgTGAAACTGTTCAC (Invitrogen)
Reverse Primer: TTTAATTAATTCAATCAGCCATC (Invitrogen)

TBK1-M559R mutation:
Forward Primer: TTAAATTGCAgGACAGAGATTTAC (Invitrogen)
Reverse Primer: CAGGACTTGTAGTTTTTCTAC (Invitrogen)

  • Thermocycler ()
  • MAX Efficiency DH5α competent E. coli cells (Thermo Fisher Scientific, #18258012)
  • SOC Medium (Thermo Fisher Scientific, #15544034)
  • Miller's LB Broth (Corning, #46-050-CM)
  • 14 mL falcon tube (Corning, #352059)
  • carbenicillin ()
  • NanoDrop Eight Spectrophotometer (ThermoFisher)
Prepare template DNA (Flag- or HA-TBK1 wild-type)
Follow the general protocol for transforming, inoculating and isolating purified GeneCopoeia ORF cDNA Clones in E. coli:
Protocol
NAME

Transforming, inoculating and isolating purified GeneCopoeia ORF cDNA Clones in E. coli

CREATED BY
Jailyn Izu
Protocol-specific parameters:

  • For Step 1, the obtain the following plasmids from GeneCopoeia:

-Flag-tagged TBK1 expression plasmid (OmicsLink‱ Expression Clone EX-U0617-M11; GeneCopoeia, Inc., Rockville, MD)

-HA-tagged TBK1 expression plasmid (OmicsLink‱ Expression Clone EX-U0617-M09; GeneCopoeia, Inc., Rockville, MD)

-Flag-tagged EGFP expression plasmid (OmicsLink‱ Expression Clone EX-EGFP-M11; GeneCopoeia, Inc., Rockville, MD), will not go through mutagenesis

-HA-tagged EGFP expression plasmid (OmicsLink‱ Expression Clone EX-EGFP-M09; GeneCopoeia, Inc., Rockville, MD), will not go through mutagenesis

  • For Step 2

-Add 1 µL of the 465 ng/μl purified stock Flag-TBK1 plasmid to 999 µL 10 Mm Tris pH 7.4 to obtain 1 mL of Flag-TBK1 (465 pg/mL)

-For the HA-TBK1 plasmid, add 1 µL of the 262 ng/μl purified stock plasmid to 499 µL 10 Mm Tris pH 7.4 to obtain 0.5 mL of HA-TBK1 (524 pg/mL).

-Dilute EGFP purified stocks in 10 Mm Tris pH 7.4 to obtain a concentration of 1-10 ng per 5 μl.
Cloning Flag- or HA-TBK1 N455S and M559R
Follow the general protocol for cloning using the NEB Site-Directed Mutagenesis Kit
Protocol
NAME

Cloning using the NEB Q5® Site-Directed Mutagenesis Kit

CREATED BY
Jailyn Izu
Protocol-specific parameters:
  • For Step 1, the template DNA is the TBK1 expression plasmid (OmicsLink‱ Expression Clone EX-U0617-M09 or EX-U0617-M11; GeneCopoeia, Inc., Rockville, MD)

  • For Step 1, the forward and reverse primer sequences are:

  • For the TBK1-N455S mutation:
Forward Primer: GATGATTACAgTGAAACTGTTCAC (Invitrogen)
Reverse Primer: TTTAATTAATTCAATCAGCCATC (Invitrogen)

  • For the TBK1-M559R mutation:
Forward Primer: TTAAATTGCAgGACAGAGATTTAC (Invitrogen)
Reverse Primer: CAGGACTTGTAGTTTTTCTAC (Invitrogen)


Sequence-verify wild-type TBK1 and the mutagenic clones
Follow the general protocol for plasmid sequencing with GeneWiz:
Protocol
NAME

GeneWiz sequencing

CREATED BY
Jailyn Izu
Protocol-specific parameters:
  • For Step 1, TBK1 is about 8 kB, so prepare 80 ng/μl template DNA
  • For Step 2, primer sequences are:

For TBK1 plasmids:
For beginning:
  • CMV: CGCAAATGGCGGTAGGCGTG (Invitrogen)

For middle:
For TBK1 wild-type:
  • Forward: AGGGGAAGATGGACAGTCTGTGT (Invitrogen)
  • Reverse: CCACCTGGAGATAATCTGCTGTCG (Invitrogen)

For TBK1 N455S:
  • Forward: GATGATTACAGTGAAACTGTTCAC (Invitrogen)
  • Reverse: TTTAATTAATTCAATCAGCCATC (Invitrogen)

For TBK1 M559R:
  • Forward: TTAAATTGCAGGACAGAGATTTAC (Invitrogen)
  • Reverse: CAGGACTTGTAGTTTTTCTAC (Invitrogen)

For end:
  • T7: TAATACGACTCACTATAGGG (Invitrogen)