Nov 11, 2022
  • Iain C. Clark1,2,3,
  • Michael A. Wheeler1,4,
  • Hong-Gyun Lee1,
  • Liliana M. Sanmarco1,
  • Zhaorong Li1,4,
  • Shravan Thaploo1,
  • Carolina M. Polonio1,
  • Seung Won Shin3,
  • Giulia Scalisi1,
  • Joseph M. Rone1,
  • Federico Giovannoni1,
  • Stephanie E. J. Zandee5,
  • Alexandre Prat5,
  • Daniel C. Douek6,
  • Eli A. Boritz6,
  • Francisco J. Quintana1,4,
  • Adam R. Abate2
  • 1Ann Romney Center for Neurologic Diseases, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115, USA;
  • 2Department of Bioengineering and Therapeutic Sciences, School of Pharmacy, University of California San Francisco, San Francisco, CA 94158, USA;
  • 3Department of Bioengineering, College of Engineering, California Institute for Quantitative Biosciences, QB3, University of California Berkeley, Berkeley, CA 94720, USA;
  • 4Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA;
  • 5Neuroimmunology Research Lab, Centre de Recherche du Centre Hospitalier de l'Université de Montréal (CRCHUM), Montreal, QC H2X 0A9, Canada;
  • 6Vaccine Research Center, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, USA
  • Clark Lab
Icon indicating open access to content
QR code linking to this content
Protocol CitationIain C. Clark, Michael A. Wheeler, Hong-Gyun Lee, Liliana M. Sanmarco, Zhaorong Li, Shravan Thaploo, Carolina M. Polonio, Seung Won Shin, Giulia Scalisi, Joseph M. Rone, Federico Giovannoni, Stephanie E. J. Zandee, Alexandre Prat, Daniel C. Douek, Eli A. Boritz, Francisco J. Quintana, Adam R. Abate 2022. FIND-seq protocol v1.0. protocols.io https://dx.doi.org/10.17504/protocols.io.q26g74o78gwz/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 08, 2022
Last Modified: November 11, 2022
Protocol Integer ID: 68379
Keywords: Single cell sequencing, RNA sequencing, droplet microfluidics, droplet cytometry, nucleic acid cytometry, seq protocol, seq, detailed description of find, dna biomarker, protocol, rna, dna, sorting cell, single cell method, key checkpoint, cell
Funders Acknowledgements:
National Institutes of Health
Grant ID: 1U01AI129206
National Institutes of Health
Grant ID: UM1AI126611
National Institutes of Health
Grant ID: NS087867
National Institutes of Health
Grant ID: ES025530
National Institutes of Health
Grant ID: ES032323
National Institutes of Health
Grant ID: AI126880
National Institutes of Health
Grant ID: AI149699
Chan Zuckerberg Biohub
Grant ID:
NMSS and Progressive MS Alliance
Grant ID:
National Institutes of Health
Grant ID: K22AI152644
National Institutes of Health
Grant ID: 1K99NS114111
National Institutes of Health
Grant ID: F32NS101790
Dana-Farber Cancer Institute
Grant ID: T32CA207201
Basic Science Research Program, National Research Foundation of Korea
Grant ID: 2021R1A6A3A14039088
Fellowship, FAPESP BEPE
Grant ID: #2019/13731-0
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
This protocol is a detailed description of FIND-seq, a single cell method for sorting cells based on RNA or DNA biomarkers. The protocol contains step-by-step instructions, key checkpoints, and troubleshooting guidelines.
Guidelines
Equipment setup for microfluidic device operation
Detailed product information of the equipment used is given in the Materials tab.

  1. Bright-field inverted microscope to visualize microfluidic device, droplet generation, re-injection, droplet sorting etc.
  2. Four syringe pumps or equivalent pumps and Air-line with pressure gauge
  3. Microtubing (PE2/PE5) to connect syringes to the device
  4. Needles (23 gauge and 27.5 gauge), Dark green blunt tip needles (14 gauge, 2” tip, luer lock connection)
  5. Sterile 1 mL syringes
  6. Microfluidic devices; CAD files of the devices are provided on the Materials tab or on the Clark lab website (https://clarklab.berkeley.edu/protocols/) used for all experiments in the paper.


Materials
Microfluidic devices CAD files
  1. Device for Bubble Trigger Download Bubble_trigger_final.dwgBubble_trigger_final.dwg
  2. Device for Reinjection Download Coflow_reinjection.dwgCoflow_reinjection.dwg
  3. Device for Sorting Download Sorter_final.dwgSorter_final.dwg

Chemistry
  1. PerfluorooctanolMerck MilliporeSigma (Sigma-Aldrich)Catalog #370533 (Caution: Wear appropriate laboratory clothing and equipment and avoid contact with skin when handling this reagent. Use it only in a fume hood.)
  2. HFE-7500 3M Novec Engineered fluidFluorochemCatalog #051243 (Caution: Avoid direct contact with this liquid, as it may cause respiratory, skin and eye irritation. Wear appropriate laboratory clothing and equipment when handling it.)
  3. Aquapel (Caution: This material is toxic and moisture sensitive. Work in a fume hood and wear appropriate protective clothing and equipment when handling it.)
  4. Automated Droplet Generation Oil for EvaGreenBio-Rad LaboratoriesCatalog #1864112
  5. Automated Droplet Generation Oil for ProbesBio-Rad LaboratoriesCatalog #1864110
  6. DTTMerck MilliporeSigma (Sigma-Aldrich)Catalog #43816-10ML
  7. EDTAVWR International (Avantor)Catalog #E177
  8. Fluorinert FC-40 Oil Merck MilliporeSigma (Sigma-Aldrich)Catalog # F9755 (Caution: Avoid direct contact with this liquid, as it may cause respiratory, skin and eye irritation.Wear appropriate laboratory clothing and equipment.)
  9. n-Hexane Alfa AesarCatalog #43263-K2 (Caution: This liquid is highly flammable and toxic. Use a fume hood and wear appropriate protective clothing and equipment when handling it.)
  10. SYLGARD™ 184 Silicone Elastomer KitDow CorningCatalog #04019862
  11. Span 80Merck MilliporeSigma (Sigma-Aldrich)Catalog #S6760
  12. Ultra-low melt Agarose IX-AMerck MilliporeSigma (Sigma-Aldrich)Catalog #A2576

Molecular Biology
  1. Ammonium Persulfate PromegaCatalog #V3131
  2. TaqPath™ qPCR Master Mix, CGThermo FisherCatalog #A15297
  3. AmpureXP beads Beckman CoulterCatalog #A63880
  4. Betaine BioUltra ≥99.0% (NT)Merck MilliporeSigma (Sigma-Aldrich)Catalog #61962
  5. Bioanalyzer chips and reagents (DNA High Sensitivity and small RNA kit)Agilent TechnologiesCatalog #5067-1548
  6. Dead Cell Removal Kit Miltenyi BiotecCatalog #130-090-101
  7. dNTP Mix (25 mM each)Thermo FisherCatalog #R1121
  8. HBSS (1x)Gibco - Thermo Fisher ScientificCatalog #14175-095
  9. KAPA HiFi Hotstart PCR kitRocheCatalog #KK2502
  10. Lithium Chloride Merck MilliporeSigma (Sigma-Aldrich)Catalog #L7026
  11. Magnesium ChlorideMerck MilliporeSigma (Sigma-Aldrich)Catalog #M1028
  12. Maxima™ H Minus Reverse TranscriptaseThermo Fisher ScientificCatalog #EP0753
  13. Maxima H- RT Buffer Thermo Fisher ScientificCatalog #EP0753
  14. NxGen® RNAse InhibitorLucigenCatalog #30281-2
  15. OptiPrep™ Density Gradient MediumMerck MilliporeSigma (Sigma-Aldrich)Catalog #D1556)
  16. PEG-8000 PromegaCatalog #V3011
  17. PEG-6000Alfa AesarCatalog #A17541
  18. Pluronic F-68Gibco - Thermo Fisher ScientificCatalog #24040-032
  19. Pluronic F-127AnaspecCatalog #AS-84040
  20. Potassium ChlorideSanta Cruz BiotechnologyCatalog #sc-301585
  21. Proteinase K, Molecular Biology Grade - 2 mlNew England BiolabsCatalog #P8107S
  22. Qubit dsDNA HS Assay kit Thermo Fisher ScientificCatalog #Q32854
  23. Qubit™ ssDNA Assay KitThermo Fisher ScientificCatalog #Q10212
  24. RNAzol RT Merck MilliporeSigma (Sigma-Aldrich)Catalog #R4533
  25. 5M NaCl solutionThermo Fisher ScientificCatalog #AM9759
  26. SYBR™ Green I Nucleic Acid Gel Stain - 10,000X concentrate in DMSOThermo FisherCatalog #S7563
  27. TEMEDInvitrogen - Thermo FisherCatalog #15524-010
  28. Tris-HCl pH 7.5 TeknovaCatalog #T5075
  29. Tris-HCl pH 8.3TeknovaCatalog #T1083
  30. Tween-20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P9416

Oligonucleotide
  1. Template switch oligonucleotide (TSO): AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG
  2. Acrydited oligo dT primer: /5Acryd/TTTTTTAAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
  3. Smart PCR primer: AAGCAGTGGTATCAACGCAGAGT

EQUIPMENT
  1. Bright-field inverted microscope (e.g., Nikon, Olympus, Zeiss, Leica)
  2. Spin coater (Laurell, model WS-650MZ-23NPP)
  3. Oxygen plasma cleaner (GaLa Instrumente, Plasma Prep 2)
  4. UV light source (OAI, model LS30/5)
  5. Ceramic hot plates (VWR, cat. no. 97042)
  6. Four syringe pumps (Harvard Apparatus, PHD 2000/2200, cat. no. 702001) or equivalent pumps such as those from KD Scientific, Chemyx, Cetoni, New Era, and so on
  7. Centrifugal mixer (Thinky, Planetary Centrifugal ‘Thinky’ mixer, cat. no. ARE-310)
  8. Benchtop centrifuge
  9. Vortex mixer
  10. Biosafety cabinet
  11. Vacuum desiccator
  12. Laser safety goggles (Thorlabs, cat. no. LG3 Orange Lens)
  13. LabVIEW software (LabVIEW Core and LabVIEW field-programmable gate array (FPGA); National Instruments)
  14. AutoCAD software (Autodesk)
  15. Silicon wafers (3-inch diameter, Type-P, 1S polished; University Wafer, cat. no. S3P01SP)
  16. Indium tin oxide (ITO) glass (50 × 75 × 0.7 mm; Delta Technologies,cat. no. CG-81IN-S207)
  17. Cover glass (24 × 60 mm, No. 1.5; Corning, cat. no. 2980-246)
  18. Glass slides (75 × 50 mm; Corning, cat. no. 2947-75X50)
  19. Low-melting-temperature solder wire (composition 32.5 Bi, 16.5 Sn,diameter 0.020 mm; The Indium Corporation of America,cat. no. wirebn-53307)
  20. Cutting mat (6 × 8 inches; Ted Pella, Harris cutting mat, cat. no. 15097)
  21. Biopsy punches (0.5 and 0.75 mm diameter; Ted Pella, Harris Uni-Core,cat. no. 15071 and 15072)
  22. Millipore filter, 0.22 µm (PVDF and polyethersulfonate type)
  23. Needles (23 gauge and 27.5 gauge; Terumo Neolus, cat. no. NN2325R)
  24. Dark green blunt tip needles (14 gauge, 2” tip, luer lock connection, McMaster Carr 75165A245)
  25. Sterile 1 mL syringes (Braun Omnifix, cat. no. 9204512)
  26. PTFE microtubing (0.56 × 1.07 mm; Fisher Scientific, cat. no. W39241)
  27. PE-2 tubing (Intramedic)
  28. PE-5 tubing (Intramedic)
  29. Hemocytometer (Hausser Scientific, cat. no. 1490)
  30. Adjustable 10, 200 and 1,000 µl pipettes and sterile pipette tips
  31. Pipettes (5, 10, 25 and 50 ml; BD Falcon, cat. no. 357543, 357771, 357550 and 357600)
  32. Sterile microcentrifuge tubes (0.5 ml and 1.5 ml)
  33. Sterile conical tubes (15 ml and 50 ml; BD Falcon, cat. no. 352196 and 352070)
  34. 100-micron cell strainer (VWR Cat. 21008‐950)
  35. 40-micron cell strainer (VWR Cat. 21008‐949)
  36. Scalpel (Becton Dickinson, No. 11, cat. no. 371611)
  37. Diamond pen (VWR, cat. no. 201-0392)
  38. Petri dishes (100 mm diameter × 15 mm; BD Falcon, cat. no. 351029)
  39. Powder-free gloves
  40. Wafer-handling tweezers
  41. Sharp tweezers
  42. Crystallizing dishes (Corning, cat. no. 3140-100)
  43. Disposable mixing cups
  44. Frosted Scotch tape
  45. Aluminum foil
  46. Qubit fluorometer (Thermo Fisher Scientific, model. no. Q32857)
  47. Razor blades (0.009 inch; Thermo Fisher Scientific, cat. no. 940115)
  48. Freezer (–20 °C; Panasonic, model. no. BZ10145190)
  49. Freezer (–80 °C; Thermo Fisher Scientific, model. no. 989)
  50. Countess II Automated Cell Counter (ThermoFisher Scientific Cat. AMQAX1000)
  51. BD 3 mL syringe adapter for centrifuge
REAGENT SETUP
20% (vol/vol) 1H-1H-2H-2H-Perfluoro-1-Octanol solution (Use this reagent immediately after preparation.)
AB
ReagentVol.
PFO10 mL
HFE-750040 mL
Total50 mL

0.1% SPAN-80 in Hexane (Use this reagent immediately after preparation.)
ABCD
ReagentReagent conc.Final conc.Vol.
Span-80 (in hexane)20% (w/v)0.1 % (w/v)0.25 mL
n-hexane--50 mL
Total50.25 mL

Cell Resuspension Buffer ( Solution is stable for several days at 4 °C .)
ABCD
ReagentReagent conc.Final conc.Vol.
HBSS buffer1X-7.2 mL
Pluronic F-6810% (v/v)1% (v/v)1 mL
Opti-prep-18% (v/v)1.8 mL
Total10 mL


Lysis Buffer (This solution is stable for several months at -20 °C and should be stored in small aliquots. When needed for experiment, add Proteinase K (2 µg/µL) to an aliquot and use immediately after preparation.)
ABCD
ReagentReagent conc.Final conc.Vol.
Tris-HCl pH 7.51000 mM20 mM0.2 mL
LiCl8000 mM1000 mM1.25 mL
LiDS10 % (v/v)1 % (v/v)1 mL
EDTA500 mM10 mM0.2 mL
DTT1000 mM10 mM0.1 mL
Proteinase K20 µg/µL2 µg/µL1 mL
Nuclease free water--6.25 mL
Total10 mL

Wash 1 Buffer (This solution is stable for several months at 4 °C .)
ABCD
ReagentReagent conc.Final conc.Vol.
Tris-HCl pH 7.51000 mM20 mM10 mL
LiCl8000 mM500 mM31.25 mL
LiDS10% (v/v)0.1% (v/v)5 mL
EDTA500 mM0.1 mM0.1 mL
Nuclease free water--453.65 mL
Total500  mL

Wash 2 Buffer (This solution is stable for several months at 4 °C .)
ABCD
ReagentReagent conc.Final conc.Vol.
Tris-HCl pH 7.51000 mM20 mM10 mL
NaCl5000 mM500 mM50 mL
Nuclease free water--440 mL
Total500 mL


5X RT Buffer (This solution is stable for several months at 4 °C .)
ABCD
ReagentReagent conc.Final conc.Vol.
Tris-HCl pH 8.31000 mM250 mM50 mL
KCl1000 mM375 mM75 mL
MgCl21000 mM15 mM3 mL
DTT1000 mM50 mM10 mL
Nuclease free water--62 mL
Total200 mL


Tween Wash Buffer (This solution is stable for several months at room temperature.)
ABC
ReagentFinal conc.Vol.
Tween-200.1% (v/v)0.5 mL
Nuclease free water-500 mL
Total500.5 mL

Conjugation Buffer (Use this reagent immediately after preparation.)
ABCD
ReagentReagent conc.Final conc.Vol.
Tris-HCl pH 8.31000 mM375 mM7.5 mL
Nuclease free water--12.5 mL


10% (wt/vol) APS (Use this reagent immediately after preparation.)
ABC
ReagentFinal conc.Amount
APS10% (w/v)0.1 g
Conjugation buffer-upto 1 mL
Total1 mL

10% (vol/vol) TEMED (Use this reagent immediately after preparation.)
ABC
ReagentFinal conc.Vol.
TEMED10% (v/v)100 µL
Conjugation buffer-900 µL
Total1000 µL
(Caution: TEMED is toxic. Addition of TEMED should be done under a chemical fume hood. Wear appropriate protective clothing and equipment when handling it.)
AGAROSE CONJUGATION
Prepare reagents for agarose conjugation. Resuspend Acrydite-T5-Smart-dT Primer in Conjugation Buffer to a concentration of 1000 micromolar (µM) (1 millimolar (mM) ). Resuspend SFR Allyl Agarose in Conjugation Buffer in a 15 mL falcon to a final concentration of 0.5 Mass / % volume . Prepare 10 Mass / % volume APS and 10 % (v/v) TEMED solutions.

Heat SFR Agarose suspended in buffer to 95 °C for 02:00:00 , or until completely molten. Vortex over time to ensure homogenization. While vortexing, it is good to flip the tube and vortex on head/cap as well. This ensures agarose near the top of the falcon does not cool and harden.

2h
Once homogenized, cool agarose to 45 °C . Temporarily placing heat block in ice is used to accomplish this faster.
Place agarose under vacuum for 00:30:00 . Ensure the agarose does not boil. If boiling is seen, agarose is not cool enough.
30m
Remove vacuum. Add reagents in the following order:
a. Add resuspended primer so final concentration of primer is 50 micromolar (µM) .
b. Add 10 Mass / % volume APS solution so the final concentration is 0.1 Mass / % volume . Vortex tube thoroughly.
c. Add 10 % (v/v) TEMED solution so the final concentration is 0.1 % (v/v) . Volume of APS and TEMED added should be the same. Vortex tube thoroughly.
Place tube back under vacuum for 04:00:00 . PAUSE POINT

4h
Remove tube from vacuum. Add the same volume of APS and TEMED as added in step 7. Final concentrations should now be 0.2 Mass / % volume APS and 0.2 % (v/v) TEMED. Vortex agarose and place under vacuum overnight at 45 °C . PAUSE POINT

Remove agarose from vacuum. Heat to 95 °C and vortex until completely molten and homogenized. Try to break polymer strands floating around by heating and vortexing as much as you can. Some strands may remain. While vortexing, it is good to flip the tube and vortex on the head/cap as well. This ensures agarose near the top of the tube does not cool and harden.

While molten, pour agarose in a 10 mL syringe with a 0.45 µm syringe filter attached. Filter agarose into another 15 mL falcon tube to remove unwanted polymer strands formed during the reaction.
Add ultra-low gelling temperature agarose to reach a final concentration of 2 Mass / % volume agarose (SFR and Ultra-low gelling together).

After addition, heat tube to 95 °C and vortex to ensure homogenization, flipping tube on head occasionally.

Once completely molten and homogenized, briefly centrifuge agarose to get all the agarose at the bottom of tube. Cool agarose to 4 °C by placing in ice bucket for at least 01:00:00 . Allow agarose to harden.

1h
Using a hypodermic needle, carefully pierce the bottom of the falcon tube. This should dislodge the hardened agarose from the bottom of the tube. Wash by transferring hard agarose gel to a 500 mL bottle of nuclease free distilled water and allow to sit overnight. PAUSE POINT
Repeat wash by re-transferring after the next night. Transfer agarose from wash bottle to a clean, dry 15 mL falcon tube. Ensure no water is transferred.
Agarose Normalization
Quantify the oligonucleotide concentration
Melt agarose at 95 °C . Vortex and homogenize. Once agarose is molten, cool down to 70 °C or until viscosity is amenable to pipetting. Use ice to cool agarose tube down.

Dilute agarose in nuclease free water (1/80 dilution). Vortex to ensure agarose added is dissolved and evenly distribute. Triplicates are ready for measurement.
In triplicate, measure conjugated oligo-dT via the QuBit ssDNA Assay kit.
Calculate the average µM concentration of conjugate oligonucleotide. Use the reported molecular weight on the IDT datasheet for the oligo-dT primer. Remember to consider the 80-fold dilution.

  1. e.g. If I get 5.52 ng/µL Qubit reading (1/80 dilution) for a 30 base ssDNA primer:
  2. Molecular concentration (µM) = Qubit reading (ng/µL) * Dilution factor (80) * 1000 / Molecular weight of total primer (g/mol)
  3. Molecular concentration (µM) = 5.52 ng/ul * 80 * 1000 / 9378.2 g/mol = 39 µM
Normalize the agarose concentration
Normalize the conjugated oligonucleotide concentration by addition of 2 Mass / % volume Ultra-low melt Agarose. Prepare 2 Mass / % volume Ultra-low melt Agarose by adding 0.08 g of agarose to 4 mL of distilled nuclease free water. Vortex and heat to 95 °C . Keep vortexing until completely dissolved.
Dilute conjugated agarose in 2 Mass / % volume Ultra-low melt Agarose to reach a final concentration of 8 micromolar (µM) conjugated oligonucleotide.

Measure final conjugated oligonucleotide concentration with QuBit ssDNA kit using the same method as above. The final concentration should be 8 micromolar (µM) .
DAY 1: CELL ENCAPSULATION AND LYSIS
1d
Heat 3 mL of conjugated agarose-Oligo dT to 95 °C for at least 01:00:00 . Vortex repeatedly to ensure homogenization and no solid clumps. CRITICAL STEP: Agarose must remain molten while running the device. Allowing agarose to cool down will clog the tubing/microfluidic channels.

1h
Prepare cells for encapsulation. It is recommended to start with at least 25-30 million cells.
Preparing cells from cell lines in culture
Wash cells 1x in HBSS 400 x g, 00:03:00 . Resuspend in 15 mL HBSS for each wash. Filter through a 70-micron strainer.

3m
Preparing PMBCs
a. Place 25 mL of RPMI with 10 % volume FBS in 37 °C for 01:00:00 .
b. Remove PBMC vial from freezer on dry ice. (CAUTION: Wear protective PPE, including a face shield, while defrosting PMBC vials.)
c. Submerge in 37 °C water bath until only a small amount of ice is visible
d. Pipette cells into media that was pre-warmed in 37 °C
e. Centrifuge cells for 300 x g, 00:10:00 .
1h 10m
Count cells using Trypan blue stain. For cell lines, you can use an automated cell counter (Countess II Automated Cell counter). For PBMCs, we recommend a manual hemocytometer.


30m
Based on the cell concentration, spin cells and resuspend in Cell Resuspension Buffer to 6.11x106 cells/mL. We recommend resuspending in smaller volume of Opti-Prep than necessary to obtain a higher concentration, and then diluting down to the required concentration.
*Troubleshooting
5m
Setup the drop making station
Keep the agarose molten and place the bubble triggered co-flow microfluidic device on the stage. Connect the syringe tubing to the microfluidic device.


Encapsulate cells in molten agarose using the bubble triggered co-flow microfluidic device at the following flow rates.

ABC
Syringe SizeReagentFinal Flow Rate
10 mLDroplet Generation Oil for Probes (BioRad). 5000 µL/hr
3 mLCells filtered and resuspended in Cell Resuspension Buffer600 µL/hr
3 mLLysis Buffer with Proteinase K 600 µL/hr
3 mLOligo-dT conjugated Agarose1200 µL/hr
-Pressured air 20 psi

Collect drops in 15 mL tubes in the heat block at 55 °C .

Incubate for 02:00:00 at 55 °C . Cool on ice or at 4 °C for at least 01:00:00 or overnight. PAUSE POINT

3h
DAY 2: BREAKING AND REVERSE TRANSCRIPTION
1d
Remove oil and wash with hexane (Caution: Hexane and PFO are highly flammable substances.)
Hardened agarose is henceforth referred to as beads. Remove oil at bottom of tube. Discard oil in appropriate waste bottle.
Add 2x-5x volume 20 % volume HFE/PFO solution to drop emulsion. Mix slowly by inverting tube by hand to adequately break emulsion.

Centrifuge at 2000 x g, 00:03:00 . Oil will be at the bottom. Remove oil. Discard oil in waste bottle.

3m
Add >25 mL of Hexane/SPAN-80 solution to the beads. Shake tubes gently until beads are not clumpy. *Troubleshooting

Centrifuge at 2000 x g, 00:03:00 . Remove hexane with a pipette and discard in a hexane waste container. (CAUTION: Hexane damages plastics and should not be aspirated. Hexane must be disposed of in a glass waste bottle.)
CRITICAL STEP: You must proceed through the reverse transcription reaction. Beads must be kept on ice at 4 °C throughout washes. Warming the beads will allow mRNA to dissociate from oligo-dT resulting in loss of mRNA and single cell resolution.
3m
Water Washes
Add up to 50 mL of 4 °C Wash 1 Buffer. Resuspend by rotating by hand, flicking the bottom of the tube if necessary. Mix thoroughly and allow to sit on ice for 00:05:00 .
CRITICAL STEP: Residual hexane will be on top after first wash. Be careful to aspirate it and not let it mix in with the rest of the solution.

5m
Centrifuge for 4500 x g, 00:05:00 . Aspirate buffer, not beads. The largest source of bead loss is getting too close to the water-agarose interface.


5m
Add up to 50 mL Wash 2 Buffer. Resuspend by rotating by hand, flicking the bottom of the tube if necessary. Mix thoroughly and allow to sit on ice for 00:05:00 .

5m
Pre-weigh a new 50 ml tube. Filter beads through 100 micron strainer into pre-weighted tube. *Troubleshooting
CRITICAL STEP: Pre-weighing the tube now is necessary for correctly setting up the reverse transcriptase reaction later in the protocol. Pre-weighed tube is used to calculate weight, and subsequently volume, of agarose beads left after washes.
Centrifuge for 4500 x g, 00:05:00 . Aspirate buffer, not beads.

5m
Add up to 50 mL Wash 2 Buffer. Resuspend by rotating by hand, flicking the bottom of the tube if necessary. Mix thoroughly and allow to sit on ice for 00:05:00 .

5m
Centrifuge for 4500 x g, 00:05:00 . Aspirate buffer, not beads
5m
Add up to 50 mL 5X RT Buffer. Resuspend by rotating by hand, flicking the bottom of the tube if necessary. Mix thoroughly and allow to sit on ice for 00:05:00 .

5m
Repeat wash (steps 36 to 38) for a total of 2 RT Buffer washes.
Reweigh tube after final aspiration to obtain weight of agarose beads.
Reverse Transcription Reaction
Beads should be in 5X RT Buffer on ice. Adding enzyme last, prepare reverse transcription reagents in a separate 50 mL falcon tube on ice as follows. Based on volume of washed beads, prepare reverse transcription mix.
ABCD
ReagentReagent conc.Final conc.Vol.
dNTP25 mM1 mM1.2 mL
TSO100 µM2 µM0.6 mL
MgCl21000 mM6 mM0.18 mL
Betaine5 M1 M6 mL
PEG-800030% (w/v)7.5% (w/v)7.5 mL
Maxima H minus Reverse transcriptase200 U/µL2 U/µL0.3 mL
NxGen Rnase inhibitor20 U/µL0.5 U/µL0.75 mL
Nuclease free water--13.47 mL
Total30 mL

Mix RT reaction using rotator for 00:30:00 at room temperature and then 01:30:00 at 42 °C on a rotator. 
2h
Take out of incubator, add 200 µL EDTA per 10 mL of reaction. Cool on ice for 00:10:00 . PAUSE POINT

10m
Alternatively, you can immediately begin bead washes with Tween Wash Buffer (next step).
Wash beads 5x in Tween Wash Buffer. On the last wash, filter with 100 micron strainer into a pre-weighed 50 mL Falcon tube.
After the final wash with Tween Wash Buffer, weigh to determine the final mass of beads.
Spin down beads for bead counting and take a 50 µL aliquot. PAUSE POINT
Bead counting
Add 50 µL of beads to 150 µL of distilled nuclease free water to create a diluted bead stock.

In a separate tube, mix a small aliquot of beads from the diluted bead stock with SYBR green (10x final concentration of dye). Let sit for 00:30:00 in the dark.

30m
Using hemocytometer, image beads fluorescence microscope. Take pictures of bead size, bead counts, and pictures at 20x magnification of bead lysis success.
Right: Bright field image of agarose beads and sizes. Left: Fluorescence images of stained genomes.

Quantify the number of beads/µL and genomes/µL. The ratio of genomes/bead should be ~1/10.
Whole Transcriptome Amplification
Set up a 25 µL PCR reaction as follows, thermocycling using three different cycle numbers (14, 16, 18). PAUSE POINT

ABCD
ReagentReagent conc.Final conc.Vol.
Kapa HiFi Master Mix2 X1 X12.5 µL
SMART PCR Primer 10 µM0.4 µM1 µL
Beads30 genomes/µLX µL
Nuclease free water--11.5 -X µL
Total25 µL

ABCDE
Thermocycling Conditions
StepStageTemperatureTimeCycles
1Initial denaturation95˚C3 minutes1x
2Denaturation98˚C15 seconds14,16,18x
Annealing67˚C20 seconds
Elongation68˚C4 minutes
3Final elongation72˚C5 minutes1x
4Hold4˚CHold

Use Ampure XP 2x beads for DNA clean-up. It is recommended to complete final elution in 20 µL - 30 µL of distilled nuclease free water. CRITICAL STEP: Over-drying of Ampure beads before elution step will result in loss of material.

Measure DNA concentration using Qubit dsDNA kit. Based on Qubit results, take aliquots of sample and resuspend them to 1 ng/µL final concentration. Run these aliquots on a Bioanalyzer chip to confirm the size of WTA product.  *Troubleshooting

A good WTA product trace from Bioanalyzer looks like so:



DAY 3: BEAD REINJECTION
1d
Prepare a 2x PCR master mix.
Mix detection PCR reagents and beads in a 15mL falcon tube so that the final concentrations are:

ABCD
ReagentReagent conc.Final conc.Vol µL
TaqMan Assay (900 nM primers, 250 nM probe)20 X1 X50
TaqPATH 2x Master Mix2 X1 X500
Tween-2010% (v/v)2.5% (v/v)50
PEG-600020% (w/v)2.5% (w/v)50
Beads350
Total1 mL
Soak for 01:00:00 on shaker in the dark at room temperature.

1h
Spin 15ml tubes at 4500 x g, 00:05:00 to separate PCR mix and beads. Separate beads and PCR mix.
Add PCR mix (20% of bead volume) to beads, vortex briefly. This prevents beads from aggregating in the device and makes reinjection stable.
5m
Load syringes
  • Load PCR mix into a 3 mL syringe with a HFE oil backing (no fluorosurfactant)
  • Load beads into a 3 mL syringe
  • Load Droplet generation oil for Evagreen into a 3 mL syringe


Place PCR mix, beads, and oil into the syringe pumps and connect the tubing to the reinjection device.


Start the reinjection device with the following flow rates, to create ~70 µm diameter droplets:

AB
ChannelFlow rate
PCR mix600 µL/hr
Beads400 µL/hr
Evagreen oil1800 µL/hr

Begin reinjection, collecting 30 µL aliquots into PCR strips. Occasionally during reinjection, verify that bead loading into droplets is close to 100% (or at least above 70%) by capturing videos.
After collection, thermocycle strips as follows with ramp rate set to 1.0 C/s

ABCD
Thermocycling Conditions
StageTemperatureTimeCycles
188˚C10 minutes1x
288˚C30 seconds55x
60˚C1 minute
34˚CHold


DAY 4: SORTING DROPLETS
4h 40m
See previously published paper of Mazutis et. al (Nat. Protoc. 2013 May;8(5):870-91.) for details on droplet sorting procedure.
Load syringes
  • Load thermocycled emulsion into a 3 mL syringe
  • Load Droplet generation oil for Evagreen into a 3 mL syringes (Oil 1)
  • Load HFE-7500 into a 3 mL syringes (Oil 2)
  • Load HFE-7500 into a 3 mL syringes (Oil 3)

Place emulsion, and oil into the syringe pumps and connect the tubing to the sorting device. Fill the saltwater electrode and moat channels with 2 M NaCl solution. Connect saltwater electrode to voltage amplifier.


Flow rates for reinjecting into a detection/sorting device:

AB
ChannelFlow rate
Emulsion100 µL/hr
Spacer oil400 µL/hr
Oil 12000 µL/hr
Oil 23000 µL/hr
Air2-5 psi
Determining cycle number for Amplification of sorted material
Cycling number is determined by performing WTA on a known number of sorted drops and calculating the number of cycles needed to obtain a desirable yield for positive drop sorts.
Sort 6-9 aliquots of the number of cells (# cells) that you will be collecting in the real experiment.
Perform WTA and bioanalyzer using 3 different cycle numbers in duplicate (or triplicate)
Plot the data and select the number of cycles that gives at least 2 ng/µL in 20 µL elution volume, or 40 ng of DNA, determined by qubit or bioanalyzer.

For Single drop sorts
Collect single drops into PCR strips.
After collection, overlay each tube with 37 µL of water.
Spin tubes at 20000 rpm, 00:05:00 .

5m
Freeze tubes at -80 °C for at least 02:00:00 or overnight. PAUSE POINT
2h
Take tubes out of freezer and heat tubes to 60 °C for 00:10:00 .
10m
Using the table below, prepare a Master mix.

ABC
ReagentReagent conc.Vol. (for single tube)
KAPA buffer5 X10 µL
dNTP10 mM1.5 µL
PCR primer100 µM0.2 µL
Kapa polymerase1 µL
Nuclease free water-0.3 µL
Total13 µL

Add 13 µL of PCR reagents for 50 µL total reaction volume.
Flick the tube to mix, spin, and thermocycle.
Thermocycle according to previously determined cycle number (Step 53).
Cleanup WTA with 1.2X Ampure XP.
Add 60 µL Ampure XP beads to 50 µL WTA reaction.
For 100 drop sorts
Collect drops in Eppendorf tubes.
Remove oil from Eppendorf tubes, leaving only a small amount to ensure that no unbroken drops are removed.
Add a 50 µL aqueous overlay (distilled nuclease-free water).

Spin tubes at 2000 rpm, 00:05:00 . Then freeze tubes at -80 °C for at least 02:00:00 or overnight. PAUSE POINT

2h 5m
Take tubes out of freezer. Heat tubes to 60 °C for 00:10:00 . Remove samples from 60 °C and carefully mix only the aqueous layer by pipet.

10m
Carefully transfer the aqueous layer in tubes to PCR strips. It is better to transfer some oil than to not transfer all aqueous.
Set up the PCR master mix as follows:
ABC
ReagentReagent conc.Vol. (for single tube)
KAPA buffer5 X10 µL
dNTP10 mM1.5 µL
PCR primer100 µM0.2 µL
Kapa polymerase1 µL
Nuclease free water4.3 µL
Total17 µL

Add 17 µL of PCR master mix to 50 µL of aqueous layer

Carefully mix by flicking the PCR tubes. Do not form emulsions. After mixing, spin tubes to separate aqueous and oil layers.
Thermocycle according to previously determined cycle number (Step 53).
Cleanup WTA with 1.2X Ampure.
Add 80.4 µL Ampure XP beads to 67 µL WTA reaction.

Troubleshooting
ABCD
Step Problem Possible Reason Solution
21Cells are all dead or counts seem incorrect. Automated Cell counter may not be able to differentiate between live and dead cells for smaller cell types like PBMCs. Cells may not have been resuspended thoroughly. Mix cell resuspension thoroughly and count cells using a hemocytometer slide.
291) Solution seems to have solidified. 2) Beads are not separating from hexane. 1) Issue with agarose concentration. 2) Generated double emulsions during addition of HFE/PFO in step 27Restart Experiment
341) Beads not passing through the filter. 2) Film of beads on filter leading to large loss 1) Beads are larger than normal (> 55 µm) and struggle to pass through 100 µm filter. 2) Beads are too concentrated. Split original tube from which beads came from into multiple tubes. Use multiple filters if necessary, adding Wash 2 Buffer to help correctly sized beads pass through the filter.
53Yield of DNA material obtained after WTA reaction is low/zero Low/zero yield may be due to failure of reverse transcription reaction or the WTA PCR. Low/zero yield may be due to mRNA loss during initial washes before reverse transcriptase reaction. This happens when buffers used are not high enough salt concentration or when beads are not kept on ice and mRNA dissociates from the poly-T tail within conjugated agarose beads. Restart Experiment