May 29, 2025
Filter-paper based PURExpress detection of ZikV and CoV2 RNA by enhancer toehold (TacToe) sensors
- 1IISER Pune
- Chaitanya Anil Athale: Supervisor, Conceptualization, Funds acquisition.
Protocol Citation: Tanvi Kale, Chaitanya Anil Athale 2025. Filter-paper based PURExpress detection of ZikV and CoV2 RNA by enhancer toehold (TacToe) sensors . protocols.io https://dx.doi.org/10.17504/protocols.io.q26g7p3p1gwz/v1
Manuscript citation:
Tanvi Kale, Rudvi Pednekar, Séverine Marianne Cazaux, Valentina Ferrando Letelier, Justin R. J. Vigar, Fernán Federici, Keith Pardee, and Chaitanya A. Athale (accepted) Translational Enhancer Based Amplification of Toehold Sensors (TacToe) for Improved Sensitivity and Speed of Viral RNA Detection. ACS Synthetic Biology
https://doi.org/10.1021/acssynbio.4c00861
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 17, 2023
Last Modified: May 29, 2025
Protocol Integer ID: 89431
Keywords: toehold, sensor, point of care, covid, zika, RNA, diagnostics, point-of-care, filter-paper, lacZ, toehold detection reaction for covid rna, purexpress detection of zikv, translational enhancer based ampli cation of toehold sensor, viral rna detection, speed of viral rna detection, rna by enhancer, based purexpress detection, transcription, covid rna, toehold detection reaction, translational enhancer based ampli cation, rna, toehold sensor, acs synthetic biology, purexpress, improved sensitivity, zikv, enhancer
Funders Acknowledgements:
Shastri Indo-Canadian Institute (SICI)
Grant ID: SCPRG
Canada’s International Development Research Centre (IDRC)
Grant ID: 109434-001
Disclaimer
This method is a scientific protocol that has not been validated on clinical samples so far.
Abstract
This method details the approach to using in vitro transcription-translation (TxTr) systems based on PURExpress adsorbed on a paper disc. These to run a toehold detection reaction for COVID RNA. The work is related to a manuscript titled "Translational Enhancer Based Ampli cation of Toehold Sensors (TacToe) for Improved Sensitivity and Speed of Viral RNA Detection" to appear in ACS Synthetic Biology.
Attachments
Materials
Whatman Filter Paper discs
Biopsy Punch (3 mm) with metal caps
PureXpress CFE
Toehold plasmid DNA
384 well plate (Corning Costar)
Before start
Before you start you need the DNA sequences that are provided in the attached files.
Reaction Kinetics using PURExpress
40m
BSA treated paper disk preparation:
1) Make 5% BSA solution in ultrapure water
2) Soak filter paper disc (Whatmann filter paper 42, ashless, dm 42.5) in BSA solution, keep it at room temperature for overnight in a beaker
3) Rinse the filter paper using ultrapure water (repeat the process for 5 times)
4) Let filter paper dry at room temperature (overnight) or at 65 ºc in hybridizer (~1-1.5h)
5) Use sterile 2mm/3mm biopsy punch to create small paper discs
6) Store the discs in sterile petri plate
PCR amplification of the sensor and the trigger from purified plasmids
The Sensors and triggers are amplified using the following primers:
| A | B | C | D | E | |
| Primer | Sequence | Length (bp) | Tm (℃) | Description | |
| 27B_LacZ_F | AACGCTGCTCTGGGCTAAC | 19 | 64.4 | Forward Primers for sensor amplification | |
| 27B_LacZ_R | CGTGTGCTTCTCAAATGCC | 19 | 64.5 | Reverse Primers for sensor amplification | |
| trig_F | TTTAGAGGCCCCAAGG | 16 | 58.7 | Forward primer for trigger amplification | |
| trig_R | GTTGCGCTAATACGACTCACTA | 22 | 60.9 | Reverse primer for trigger amplification |
Following are the lengths of the amplicons (linearised sensor/trigger):
| A | B | C | |
| Amplicon | Amplicon length (bp) | Primers used to amplify | |
| ZIKV 27B | 3305 | 27B_LacZ_F and 27B_LacZ_R | |
| ZIKV TacToe | 3326 | ||
| COV TacToe | 3327 | ||
| ZIKV Trigger | 400 | trig_F and trig_R | |
| COV Trigger | 233 |
Prepare the following reaction mix (Master-mix):
DNA working concentration:
ZIKV:
Toehold: 24nM
Trigger: 54nM
COV:
Toehold: 0.3nM
Trigger: 8nM
Components Working Conc. Blank(μl) Test(μl)
Buffer A* 2.01 2.01
Buffer B* 1.5 1.5
CPRG (20mg/ml) 0.6ug/ml 0.21 0.21
Rnase inhibitor 0.5 0.5
Toehold DNA (Adjust depending on the yield and the reaction requirements)
Trigger DNA (Adjust depending on the yield and the reaction requirements)
Water 2.78 -
Total Volume 7 7
*Buffer A and B are the two mixes from NEB's PURExpress
Buffer B 1.5 1.5 on ice while preparing the master-mix
30m
From the 7 μl master-mix, pipette out 2μl on each paper-disk placed in a 384 well plate to get triplicates of each reaction (2μl x 3).
10m
Measure absorbance at 570nm over 100 minutes at a 1 minute interval in a plate reader incubated at 37℃
1h 40m
Freeze drying disks with CFE (Home-made or PURExpress)+ CPRG
1. Cell free reaction (Mastermix + CFE) applied on paper discs (3mm)(Mastermix 1.02ul +CFE 0.44ul)
2. Air dry
3. Flash freeze in liquid Nitrogen
4. Put the disc in PCR tubes (1disc/tube). Make 4 small holes on capusing sterile syringe.
5. Put the tubes in lyophilizer @-75 ºC, 4 hour , 0.04 mbar pressure
6. Samples store @Room Temperature in sterile falcon with silica inside
7. Rehydration: Plasmid (~24nM) + water (0.54ul)
Acknowledgements
The work was supported by funding from the Shastri Indo-Canadian Institute (SICI) Shastri Covid-19 Pandemic Response Grant (SCPRG) and Canada’s International Development Research Centre (IDRC) (109434-001) through the Canadian 2019 Novel Coronavirus (COVID-19) Rapid Research Funding Opportunity and the National Agency for Research and Development (ANID). ZIKV Sensor27B 772 LacZ and ZIKV NASBA 27B were a gift from James Collins & 773 Alexander Green (Addgene plasmids #75010 and #75006).