Jul 11, 2024

Public workspaceEzrin plasmids

  • 1Duke University
Icon indicating open access to content
QR code linking to this content
Document CitationShiyi Wang 2024. Ezrin plasmids. protocols.io https://dx.doi.org/10.17504/protocols.io.e6nvwjww7lmk/v1
License: This is an open access document distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Created: May 24, 2023
Last Modified: July 11, 2024
Document Integer ID: 82338
Keywords: ASAPCRN
Funders Acknowledgements:
Aligning Science Across Parkinson’s (ASAP) initiative
Grant ID: ASAP-020607
Abstract
How Ezrin plasmids were made.
1. pZac2.1-GfaABC1D-Lck-GCaMP6f was a gift from Dr. Baljit Khakh (Addgene plasmid #52924).

2. pZac2.1-GfaABC1D-BioID2-HA was generated by PCR of BioID2 from pAAV-hSyn-BioID2-Linker-Synapsin1a-HA (primers Fw: 5’-ctagcctcgagaattcaccatgttcaaaaatcttatttg-3’, Rv: 5’-ccgggtcgactctagatgcgtaatccggtacatcg-3’) and insertion into the EcoRI and XbaI restriction sites of pZac2.1-GfaABC1D-Lck-GCaMP6f using In-Fusion cloning (TaKaRa).

3. pHJ421(pEGFP-Ezrin WT) and pHJ423 (pEGFP-Ezrin T567D) were a gift from Stephen Shaw (Addgene plasmid # 20680 and # 20681).

4. pZac2.1-GfaABC1D-Ezrin WT-BioID2-HA and pZac2.1-GfaABC1D-Ezrin T567D-BioID2-HA were generated by PCR of Ezrin from pHJ421 or pHJ423 (primers Fw: 5’-ctagcctcgagaattcaccatgccgaaaccaatca-3’, Rv: 5’-tgaacatggtgaattccgacagggcctcgaactcg-3’) and insertion into the EcoRI restriction sites of pZac2.1-GfaABC1D-BioID2, respectively.

5. To generate pZac2.1-GfaABC1D-Ezrin T567A-BioID2-HA plasmid, Q5® Site-Directed Mutagenesis Kit (NEB) was used with mutagenesis primers (Fwd: CAAGTACAAGGCGCTGCGGCAGA; Rev: TCCCGGCCTTGCCTCATG)