Jan 15, 2023

Extraction of fungal DNA and PCR for identification using the Sigma-Aldrich REDExtract Plant PCR kit

This protocol is a draft, published without a DOI.
  • 1University of Auckland
Icon indicating open access to content
QR code linking to this content
Protocol CitationSiouxsie Wiles, Shara Van De Pas 2023. Extraction of fungal DNA and PCR for identification using the Sigma-Aldrich REDExtract Plant PCR kit. protocols.io https://dx.doi.org/
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 24, 2022
Last Modified: January 15, 2023
Protocol  Integer ID: 73229
Keywords: DNA, fungi, fungus, DNA extraction, colony PCR, ITS, extraction of fungal dna, dna from fungal mycelium, aldrich redextract plant pcr kit, aldrich redextract plant pcr kit this protocol, fungal dna, redextract plant pcr kit, fungal mycelium, pcr for identification, extraction, dna, pcr
Abstract
This protocol describes how we use the REDExtract Plant PCR kit (Sigma-Aldrich) to extract DNA from fungal mycelium and PCR from the ITS region.
Guidelines
Make sure your fungal plates aren't contaminated!
Materials
Plasticware

DescriptionCatalogue NumberSupplier
PCR tubesTFI0201Bio Rad laboratories
Pipette tips
Chemicals and Kits
DescriptionCatalogue NumberSupplier
REDExtract, Plant PCR KitXNAPSigma-Aldrich (New Zealand)
Ultrapure water10977015Life Technologies New Zealand
AgaroseA-1280-100pH Scientific Limited
Sybrsafe DNA Gel StainS33102Thermo Fisher Scientific
TAE bufferPMV4271In vitro technologies
1kb ladderSMO313Life Technologies New Zealand
Primers:

PrimerSequence
ITS1F5' CTTGGTCATTTAGAGGAAGTAA 3'
ITS45' TCCTCCGCTTATTGATATGC 3'

Equipment:

  • Pipettes - various sizes
  • Thermocycler PCR machine for cell lysis and colony PCR
  • Micro centrifuge
  • Powerpack for gel electrophoresis
Before start
You will need to prepare your fungal cultures so that you have visible mycelium for extraction.
DNA Extraction
Place 30 ul extraction solution into PCR tubes. Using a small sterile pipette tip place a small piece of mycelium so its only just visible on the tip into the tube. Vortex and briefly centrifuge.
Place PCR tubes into the PCR machine and run a cell break protocol (95 °C for 10 minutes).
Cool down and add 30µl dilution solution.
Dilute the samples as needed. Start with 1:20 and go to 1:10 or 1:5 if needed.
Store the extracted DNA at -20 °C until PCR.

PCR
Make a master mix based on 9 µl per single reaction

Recipe per PCR sample (single reaction = 9 µl)

ComponentVolume per single reactionVolume based on 10 samples*
Reaction mix5µl65µl
Forward primer0.5µl6.5µl
Reverse primer0.5µl6.5µl
Dilution solution0.5µl6.5µl
Extraction solution0.5µl6.5µl
Ultrapure H2O2µl26µl
*Total preparation amount = number of samples + 1 negative control + 2 extra to cover pipetting errors.

Aliquot 9µl of master mix into individual PCR tubes.
Add 1µl of extracted DNA sample to each aliquot of master mix.
Centrifuge samples briefly (just a few seconds) in a benchtop centrifuge to ensure they are at the bottom of the tube.
Place tubes into PCR machine and run using the following settings:

1x 94 °C - 3 minutes.

35-40x cycles of:
94 °C - 30 seconds
52 °C - 30 seconds
72 °C - 30 seconds (For LSU primers use 72 °C for 40 sec)
1x 72 °C - 7 minutes

Gel electrophoresis
Make a 1% molecular grade agarose gel using 1x fresh TAE. Microwave until the agar has just dissolved.
Note. 100ml for running 25 samples, 35ml for 13 samples
Add 2µL Sybrsafe stain per 50ml volume of agar
Pour into setup gel tray, add comb and leave for half an hour or until set.
Place the set gel into the gel tank (make sure the wells are at the negative end).
Fill the tank with waste TAE until entire gel is submerged - can top up with fresh TAE if needed.
Load 2-5µl of sample into each well including a 1kb ladder and negative controls
Set powerpack to run at 90v for 30mins
After gel is run gently lift the tray out of the tank and movie it onto a sybersafe tray view bands in the gel viewer.