Apr 14, 2026
Extraction of DNA from canine feces for detection of Campylobacter jejuni using the MagMaxTM CORE Nucleic Acid Purification Kit on KingFisherTM Flex Instrument
- Sara D. Lawhon1,
- Ching-Yuan Yang1,
- Melanie Prarat2,
- Jing Wu1
- 1Texas A&M University - College Station;
- 2Ohio Animal Disease Diagnostic Laboratory
- Vet LIRN
Protocol Citation: Sara D. Lawhon, Ching-Yuan Yang, Melanie Prarat, Jing Wu 2026. Extraction of DNA from canine feces for detection of Campylobacter jejuni using the MagMaxTM CORE Nucleic Acid Purification Kit on KingFisherTM Flex Instrument. protocols.io https://dx.doi.org/10.17504/protocols.io.8epv5j1b5l1b/v1
Manuscript citation:
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 27, 2022
Last Modified: April 14, 2026
Protocol Integer ID: 70577
Keywords: campylobacter jejuni, dna extraction, manual dna extraction method, extraction of dna, kingfishertm flex instrument campylobacter jejuni, feces for the detection, feces for detection, campylobacter, rapid detection of animal, foodborne illness, extraction, significant cause of foodborne illness, cause of foodborne illness, magmaxtm core nucleic acid purification kit, rapid detection, veterinary patient, fece
Funders Acknowledgements:
U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network
Grant ID: U18FD005013
U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network
Grant ID: U18FD006171
U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network
Grant ID: U18FD006446
U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network
Grant ID: U18FD006664
U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network
Grant ID: U18FD007242
Disclaimer
Reference to any commercial materials, equipment, or process does not in any way constitute approval, endorsement, or recommendation by the Food and Drug Administration.
The authors thank the members of the U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network who reviewed and tested the method during multiple interlaboratory comparison exercises and blinded method tests.
Abstract
Campylobacter jejuni is a significant cause of foodborne illness in humans and animals. Rapid detection of animals shedding C. jejuni is a key step in limiting the scope of outbreaks and reducing the potential exposure of humans and other animals. Manual DNA extraction methods, although effective, can be labor-intensive and time-consuming. The utilization of automated or semi-automated methods can significantly reduce the time needed for DNA extraction and significantly increase the number of samples that can be processed in a given amount of time. This method was developed to provide a standard method for semi-automated DNA extraction from feces for the detection of C. jejuni in veterinary patients.
Validation data (in-house and by an independent laboratory via collaborative study such as Randomized Blinded Method Test) are available upon request.
Image Attribution
Sara Lawhon
Guidelines
All manufacturers' intended use, safety information, storage guidelines, and recommendations should be followed.
Campylobacter jejuni is infectious to humans and is a biological safety level 2 organism. All work with specimens that potentially contain C. jejuni should follow the best practices outlined in the most current version of Biosafety in Microbiological and Biomedical Laboratories (BMBL) and institutional guidance.
Reporting of positive test results should follow all local, state, and federal regulations.
Follow the MagMaxTM CORE Nucleic Acid Purification Kit manufacturer's recommendations, warnings and procedural guidelines.
Materials
For DNA Extraction
1X PBS (Life Technologies cat#10010-023)
Applied Biosystems™ MagMAX™ CORE Nucleic Acid Purification Kit (ThermoFisher Scientific, cat#A32700/A32702)
VetMAX™ Xeno™Internal Positive Control DNA (ThermoFisher cat#s A29762/A29764)
Adhesive PCR Plate Foils, or equivalent (ThermoFisher Scientific, cat# AB0626)
Plasticware - please confirm that plasticware works with your equipment.
KingFisher™ 96 tip comb for DW magnets, 100 combs (ThermoFisher Scientific, cat#97002534)
KingFisher™ Flex Microtiter Deepwell 96 plates (ThermoFisher Scientific, cat#95040460)
KingFisher™ 96 KF microplates (200 μL), (ThermoFisher Scientific, cat#97002540)*
*Note: Only works with KingFisher™ Flex 96 Heating Block (Cat. No. 24075420). Not to be used with KingFisher™ Flex 96 Deep-Well Heating Block (Cat. No. 24075430).
From any manufacturer:
Microcentrifuge tubes - 1.5-mL and 2-mL tubes sterile
50 mL conical tubes - sterile
Pipette tips (1 mL, 200 µL, 20 µL and 10 µL)
Serological pipette, 25 mL
For PCR
TaqMan Fast Virus 1-step Master Mix (ThermoFisher Cat. Nos. 4444432/4444434/4444436)
VetMAX™ Xeno™ Internal Positive Control - VIC™ Assay (ThermoFisher Scientific A29765 or A29767)
Positive control DNA from C. jejuni ATCC 33291, ATCC 33292, or ATCC 33560
Negative control DNA from E. coli ATCC 25922
| A | B | |
| Oligo Name | 5’-3’ Sequence | |
| gyrA-F | AAGATACGGTCGATTTTGTTCCA | |
| gyrA-R | CTACAGCTATACCACTTGAACCATTTAATA | |
| gyrA-P | 5’-[FAM]TGATGGTTCAGAAAGCGAACCTGATGTTTT[BHQ1]-3’ |
Primer and probe sequences.
Primers and probe are diluted to a working concentration of 10 µM with a final concentration in the total reaction volume of 0.5 µM.
Equipment needed:
KingFisher™ Flex Magnetic Particle Processor (ThermoFisher Scientific, cat#5400110)
Biotang Inc Microplate Shaker, or equivalent titer plate shaker (for mixing beads with samples; Fisher Scientific™ cat#50-751-4965)
Applied Biosystems™ 7500 Fast Real-Time PCR System or similar real-time PCR machine
Scale for weighing 8 g of feces
Pipettes for appropriate volumes
Centrifuge for microcentrifuge tubes capable of speeds of up to 16,000 Χ g
Benchtop centrifuge with plate adaptors (for lysate preparation in plates
Laboratory mixer, Vortex or Equivalent
Optional: Qiagen (MoBio) Vortex Adapter (Cat#13000-V1-24)
Reference for primers and probe
Iijima Y, Asako NT, Aihara M, Hayashi K. (2004) Improvement in the detection rate of diarrhoeagenic bacteria in human stool specimens by a rapid real-time PCR assay. J Med Microbiol. 2004 Jul;53(Pt 7):617-22. PMID: 15184531
Protocol materials
VetMAX Xeno Internal Positive Control NDThermo Fisher ScientificCatalog #A29762/A29764
1X PBSLife TechnologiesCatalog #10010-023
MagMAX™ CORE Nucleic Acid Purification Kit Thermo Fisher ScientificCatalog #A32700/A32702
Safety warnings
All manufacturers' intended use, safety information, storage guidelines, and recommendations should be followed.
Appropriate safety and personal protective equipment should be worn while working with chemicals including a suitable lab coat, disposable gloves, and protective eyewear.
Campylobacter jejuni is infectious to humans and is a biological safety level 2 organism. Work with specimens that may contain this organism should follow all applicable institutional safety guidelines.
Background
Fecal samples should be stored at 4-8 °C refrigerated until processed.
Samples should be processed within 72 hours of receipt at the laboratory.
If performing bacterial culture, bacterial culture plates and enrichment broth should be incubated in a microaerophilic environment at 42 °C + or - 2 .
Remaining samples from the associated culture method can be used for molecular detection.
Before using the MagMaxTM CORE Nucleic Acid Purification Kit, invert bottles of solutions and buffers to ensure thorough mixing.
In this protocol, you will mix samples with reagents from the MagMaxTM CORE Nucleic Acid Purification Kit by either using a plate shaker or by pipetting up and down.
If you are using a plate shaker, you will want to determine the maximum setting of your plate shaker prior to running samples.
First verify that the plate fits securely on the plate shaker.
Test the maximum setting that you can use on the plate shaker by adding 1 mL of water to each well of a test plate and then covering the plate with sealing foil.
Next, determine the maximum setting that you can use on your shaker without any of the water splashing onto the sealing foil.
To prevent cross-contamination, 1) cover the plate or tube strip during the incubation and shaking steps, to prevent spill-over and 2) carefully pipet reagents and samples to avoid splashing.
To prevent nuclease contamination, wear laboratory gloves throughout all procedures, use nucleic acid-free pipette tips to handle reagents, and decontaminate the lab benches and pipettes before use.
This protocol uses VetMAX Xeno Internal Positive Control NDThermo Fisher ScientificCatalog #A29762/A29764 as a control for PCR inhibition.
Note
Note: This reagent will be added to the MagMAX™ CORE Lysis Solution as a DNA extraction control and/or after DNA extraction is complete to serve as the PCR inhibition control. If the laboratory has a system in place for DNA extraction and PCR inhibition, that method can be substituted in this protocol.
Prior to using this protocol, the script for the MagMAX™ CORE kit should be loaded onto the instrument. The script is: KingFisher Flex heated script: MagMAX CORE_Flex.bdz
Sample preparation
2m 30s
Use 8 g of feces in 50 mL conical tubes
Add 32 mL 1X PBSLife TechnologiesCatalog #10010-023 to 8 g of feces. The feces in PBS will hereafter be called the feces-PBS slurry.
Making the Feces-PBS slurry.
Allow samples to sit for 00:02:00 after adding the 32 mL PBS
2m
Vortex samples for 00:00:30 to prepare fecal slurry
30s
PCR Method - DNA Extraction
1m
Extract DNA from the feces using the MagMAX™ CORE Nucleic Acid Purification Kit Thermo Fisher ScientificCatalog #A32700/A32702 following the manufacturer's protocol (outlined below).
Before processing the fecal slurry, prepare the Processing Plates.
| A | B | C | D | E | |
| Plate ID | Plate Position | Plate Type | Reagent | Volume per well | |
| Sample Plate | 1 | Deep Well | *The sample plate will be set up in subsequent protocol steps and will be loaded on the KingFisher™ Flex Instrument at Step 24. | ||
| Wash Plate 1 | 2 | Deep Well | MagMAX™ CORE Wash Solution 1 | 500 μL | |
| Wash Plate 2 | 3 | Deep Well | MagMAX™ CORE Wash Solution 2 | 500 μL | |
| Elution | 4 | Standard | MagMAX™ CORE Elution Buffer | 90 μL | |
| Tip Comb | 5 | Standard | Place a tip comb in the plate |
Table 1. Plate setup: KingFisher™ Flex instrument
Before processing the fecal slurry, prepare the Bead-Proteinase K mix.
Vortex the MagMAX™ CORE Magnetic Beads thoroughly to ensure that the beads are fully resuspended.
Combine the following components for the required number of samples plus 10%.
| A | B | |
| Component | Volume per sample | |
| MagMAX™ CORE Magnetic Beads | 20 μL | |
| MagMAX™ CORE Proteinase K | 10 μL | |
| Total Bead/PK Mix | 30 μL |
Table 2. Preparation of the Magnetic Beads and Proteinase K
Note
The manufacturer recommends that you prepare new Bead/PK mix for each processing run. If necessary, the Bed PK mix can be stored at 4 °C for up to 1 week.
Add the Bead/PK Mix to the wells in Sample Plate
Prepare the CORE Lysis Solution.
Combine the following components for the required number of samples plus 10%.
| A | B | |
| Component | Volume per sample | |
| MagMAX™ CORE Lysis Solution | 450 μL | |
| VetMAX™ Xeno™ Internal Positive Control DNA | 4 μL | |
| Total Lysis Solution and Internal Positive Control DNA | 454 μL |
Table 2. Preparation of the Lysis Solution
Note
Validation of the protocol used 4 µL VetMAX™ Xeno™ Internal Positive Control DNA per reaction instead of the 2 µL as noted in the manufacturer's protocol for consistency with prior manual extraction methods. Laboratories may choose to validate the use of 2 µL VetMAX™ Xeno™ Internal Positive Control DNA per reaction internally.
Mix by inverting the tube or bottle at least 10 times.
Note
(Optional) Store Lysis Solution at room temperature for up to 24 hours.
To a microcentrifuge tube, add 1 mL of feces-PBS slurry from Sample Preparation Step 12.
Pipetting the Feces-PBS slurry to a microcentrifuge tube.
Centrifuge the sample at 100 x g, Room temperature, 00:01:00
1m
Samples can be processed either in tubes (Step 20) or plates (Step 21)
Processing in tubes
Add 454 µL of the Lysis Solution to a new 2-mL tube.
Transfer 200 µL of the supernatant of the centrifuged fecal slurry to the tube.
Vortex vigorously for00:03:00 or until the sample is suspended.
Note
Optional - The sample in the microcentrifuge tube can be placed in a vortexer with Qiagen (MoBio) Vortex Adapter (Cat#13000-V1-24)
3m
Centrifuge the sample at 15000 x g, Room temperature, 00:02:00
2m
Without disturbing the pellet, transfer 200 µL of the the supernatant (clarified lysate) to the Sample Plate containing the Bead/PK Mix from Step 15 and proceed to Step 22.
Processing samples in Plates
Add 454 µL of the Lysis Solution to the appropriate wells of a deep-well plate.
Transfer 200 µL of the supernatant of the fecal slurry to the tube.
Seal the plate with sealing foil.
Shake the plate at moderate speed for 5 minutes.
Centrifuge at 3000 x g, Room temperature, 00:05:00 .
5m
Remove the supernatant (clarified lysate) without disturbing the pellet and transfer 200 µL to the Sample Plate containing the Bead/PK Mix from Step 15 and proceed to Step 22.
Mix the clarified lysate (sample) and bead mix for 00:02:00 at Room temperature .
2m
Add 350 µL of MagMAX™ CORE Binding Solution to the clarified lysate-bead mixture in wells of the Sample Plate.
Immediately proceed to process the samples on the KingFisher™ Flex instrument
Select the appropriate script on the instrument. KingFisher Flex heated script: MagMAX CORE_Flex.bdz
00:27:00
Note
Processing on the machine takes approximately 27 minutes.
27m
PCR Method - Setting up and running the PCR reactions
The probe is labeled with FAM with Black Hole Quencher 1 (BHQ1) so detection parameters appropriate for FAM or SYBR should be used.The developing laboratory uses Applied Biosystems™ VetMAX™ Xeno™ Internal Positive Control DNA (ThermoFisher Scientific A29762 or A29764) and the VetMAX™ Xeno™ Internal Positive Control - VIC™ Assay (ThermoFisher Scientific A29765 or A29767) to monitor for PCR inhibition.
PCR Method - DNA Extraction
1m
After samples have finished processing, proceed with PCR or store samples at 4 °C until ready to perform PCR.
PCR Method - Setting up and running the PCR reactions
Create run on ABI 7500 Fast machine. Setting up the ABI 7500 Fast Thermocycler: Refer to the manual provided for running the machine. Reaction times are as follows in Table 1.
Equipment
7500 Fast Real-Time PCR System, desktop
NAME
Applied Biosystems
BRAND
4351107
SKU
| A | B | C | D | E | F | |
| Stage | Function | Temperature | Duration (sec) | Repeats | Optics | |
| Reverse Transcription | 50°C | 300 | ||||
| Stage 1 | Initial PCR Activation | 95.0°C | 20 | Off | ||
| Stage 2 | Annealing | 95.0°C | 3 | Repeats 45 times | Off | |
| Stage 2 | Extension | 60°C | 60 | On |
Table 4a. PCR amplification conditions in ABI 7500 under standard conditions are as follows:
| A | B | C | D | E | F | |
| Stage | Function | Temperature | Duration (sec) | Repeats | Optics | |
| Reverse Transcription | 50°C | 300 | ||||
| Stage 1 | Initial PCR Activation | 95.0°C | 20 | Off | ||
| Stage 2 | Annealing | 95.0°C | 3 | Repeats 45 times | Off | |
| Stage 2 | Extension | 60°C | 60 | On |
Table 4b. PCR amplification conditions in ABI 7500 under FAST conditions are as follows:
Note
Passive reference dye should be set as ROX
Calculate the number of PCR reactions to be performed. Using Table 5 as a guide, determine the quantity of each reagent needed. Include a positive (C. jejuni ATCC 33291, ATCC 33292, or ATCC 33560) and negative (E. coli ATCC 25922) control and a “No Template” negative control.
For calculations, reference Table 5. PCR Worksheet for Reagent Volumes for Master Mix Preparation for Campylobacter jejuni PCR.
Table 5. PCR Worksheet for Reagent Volumes for Master Mix Preparation for Campylobacter jejuni PCR.xlsx Combine reagents except for the DNA template in a 1.5ml or 2ml microcentrifuge tube and mix well.
Aliquot 18 µL into each PCR tube or reaction well if using a plate.
Add samples and positive (C. jejuni ATCC 33291, ATCC 33292, or ATCC 33560 DNA) and negative (E. coli ATCC 25922 DNA) controls along with PCR inhibition controls VetMAX Xeno Internal Positive Control NDThermo Fisher ScientificCatalog #A29762/A29764
Place Samples in thermocycler and perform run.
Following run, analyze the results. Results should be reported with a Ct value and interpretation.
Samples with a Ct value of 40 or less should be interpreted as positive. Samples with a Ct value >40 or an undetermined Ct value should be considered negative.
| A | B | C | |
| Target | CT Value | Interpretation | |
| gyrA | <=40 | Detected | |
| >40 | Not detected |
Table 6.Interpretation of Ct Value
| A | B | |
| Oligo Name | 5’-3’ Sequence | |
| gyrA-F | AAGATACGGTCGATTTTGTTCCA | |
| gyrA-R | CTACAGCTATACCACTTGAACCATTTAATA | |
| gyrA-P | 5’-[FAM]TGATGGTTCAGAAAGCGAACCTGATGTTTT[BHQ1] 3’ |
Table 7. Primers and Probe
Protocol references
Life Technologies Corporation. 2017. MagMAX™ CORE Mechanical Lysis Module USER GUIDE. Publication Number MAN0015945 Revision A.0. Austin, TX. https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2FMAN0015945-MagMAXCORE-Mech-Lysis-Module-UG.pdf