Extraction of DNA from canine feces for detection of Campylobacter jejuni using MagMaxTM CORE Nucleic Acid Purification Kit on KingFisherTM DuoPrime Instrument
Protocol Citation: Sara D. Lawhon, Ching-Yuan Yang, Melanie Prarat, Jing Wu 2026. Extraction of DNA from canine feces for detection of Campylobacter jejuni using MagMaxTM CORE Nucleic Acid Purification Kit on KingFisherTM DuoPrime Instrument. protocols.io https://dx.doi.org/10.17504/protocols.io.14egn286mg5d/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 23, 2022
Last Modified: April 14, 2026
Protocol Integer ID: 70451
Keywords: campylobacter jejuni, kingfishertm duoprime instrument campylobacter jejuni, dna extraction, manual dna extraction method, extraction of dna, feces for the detection, feces for detection, campylobacter, rapid detection of animal, foodborne illness, extraction, using magmaxtm core nucleic acid purification kit, significant cause of foodborne illness, magmaxtm core nucleic acid purification kit, cause of foodborne illness, rapid detection, veterinary patient, fece
Funders Acknowledgements:
U.S. Food and Drug Administration Vet-LIRN Program
Grant ID: U18FD005013
U.S. Food and Drug Administration Vet-LIRN Program
Grant ID: U18FD006171
U.S. Food and Drug Administration Vet-LIRN Program
Grant ID: U18FD006446
U.S. Food and Drug Administration Vet-LIRN Program
Grant ID: U18FD006664
U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network
Grant ID: U18FD007242
Disclaimer
Reference to any commercial materials, equipment, or process does not in any way constitute approval, endorsement, or recommendation by the Food and Drug Administration.
The authors thank the members of the U.S. Food & Drug Administration Veterinary Laboratory Investigation and Response Network who reviewed and tested the method during multiple interlaboratory comparison exercises and blinded method tests.
Abstract
Campylobacter jejuni is a significant cause of foodborne illness in humans and animals. Rapid detection of animals shedding C. jejuni is a key step in limiting the scope of outbreaks and reducing the potential exposure of humans and other animals. Manual DNA extraction methods, although effective, can be labor-intensive and time-consuming. The utilization of automated or semi-automated methods can significantly reduce the time needed for DNA extraction and significantly increase the number of samples that can be processed in a given amount of time. This method was developed to provide a standard method for semi-automated DNA extraction from feces for the detection of C. jejuni in veterinary patients.
Validation data (in-house and by an independent laboratory via collaborative study such as Randomized Blinded Method Test) are available upon request.
Guidelines
All manufacturers' intended use, safety information, storage guidelines, and recommendations should be followed.
Campylobacter jejuni is infectious to humans and is a biological safety level 2 organism. All work with specimens that potentially contain C. jejuni should follow the best practices outlined in the most current version of Biosafety in Microbiological and Biomedical Laboratories (BMBL) and institutional guidance.
Reporting of positive test results should follow all local, state, and federal regulations.
Follow the MagMaxTM CORE Nucleic Acid Purification Kit manufacturer's recommendations, warnings and procedural guidelines.
VetMAX™ Xeno™Internal Positive Control DNA (ThermoFisher cat#s A29762/A29764)
VetMAX™ Xeno™ Internal Positive Control - VIC™ Assay (ThermoFisher Scientific A29765 or A29767)
From any manufacturer:
Microcentrifuge tubes - 1.5 mL, sterile
50 mL conical tubes - sterile
Pipette tips (1 mL, 200 µL, 20 µL and 10 µL)
Serological pipette, 25 mL
For PCR
TaqMan Fast Virus 1-step Master Mix (ThermoFisher Cat. Nos. 4444432/4444434/4444436)
Positive control DNA from C. jejuni ATCC 33291, ATCC 33292, or ATCC 33560
Negative control DNA from E. coli ATCC 25922
A
B
Oligo Name
5’-3’ Sequence
gyrA-F
AAGATACGGTCGATTTTGTTCCA
gyrA-R
CTACAGCTATACCACTTGAACCATTTAATA
gyrA-P
5’-[FAM]TGATGGTTCAGAAAGCGAACCTGATGTTTT[BHQ1]-3’
Primer and probe sequences.
Primers and probe are diluted to a working concentration of 10 µM with a final concentration in the total reaction volume of 0.5 µM.
Equipment needed:
KingFisher™ Duo Prime Magnetic Particle Processor (ThermoFisher Scientific, cat#5400110)
Scale for weighing 8 g of feces
Pipettes for appropriate volumes
Centrifuge for microcentrifuge tubes capable of speeds of up to 16,000 Χ g
Vortexer for the fecal slurry
Vortexer with Qiagen (MoBio) Vortex Adapter (Cat#13000-V1-24) (optional)
Reference for primers and probe
Iijima Y, Asako NT, Aihara M, Hayashi K. (2004) Improvement in the detection rate of diarrhoeagenic bacteria in human stool specimens by a rapid real-time PCR assay. J Med Microbiol. 2004 Jul;53(Pt 7):617-22. PMID: 15184531
Protocol materials
VetMAX Xeno Internal Positive Control NDThermo Fisher ScientificCatalog #A29762/A29764
All manufacturers' intended use, safety information, storage guidelines, and recommendations should be followed.
Appropriate safety and personal protective equipment should be worn while working with chemicals including a suitable lab coat, disposable gloves, and protective eyewear.
Campylobacter jejuni is infectious to humans and is a biological safety level 2 organism. Work with specimens that may contain this organism should follow all applicable institutional guidelines.
Background
Fecal samples should be stored at 4-8 °C refrigerated until processed.
Samples should be processed within 72 hours of receipt at the laboratory.
Plates and enrichment broth should be incubated in a microaerophilic environment at 42 °C + or - 2.
Remaining samples from the associated culture method can be used for molecular detection.
This protocol uses VetMAX Xeno Internal Positive Control NDThermo Fisher ScientificCatalog #A29762/A29764 as a control for PCR inhibition.
Note
Note: This reagent can either be added to the CORE Lysis Solution at step 10 to serve as a DNA extraction control or after DNA extraction is complete to serve as the PCR inhibition control. If the laboratory has a system in place for DNA extraction and PCR inhibition, that method can be substituted in this protocol.
Prior to using this protocol, the script for the MagMAX™ CORE kit should be loaded onto the instrument.
Add 32 mL1X PBSLife TechnologiesCatalog #10010-023 to 8 g of feces. The feces in PBS will hereafter be called the feces-PBS slurry.
Making the Feces-PBS slurry.
Allow samples to sit for 00:02:00 after adding the 32 mL PBS
2m
Vortex samples for 00:00:30 to prepare fecal slurry
30s
PCR Method - DNA Extraction
1m
Extract DNA from the feces using the MagMAX™ CORE Nucleic Acid Purification Kit Thermo Fisher ScientificCatalog #A32700/A32702 following the manufacturer's protocol (outlined below).
Before processing the fecal slurry in Step 14, prepare the Bead-Proteinase K mix.
Vortex the MagMAX™ CORE Magnetic Beads thoroughly to ensure that the beads are fully resuspended.
Combine the following components for the required number of samples plus 10%.
A
B
C
Component
Volume per sample
Volume for 12 reactions + 10%
MagMAX™ CORE Magnetic Beads
20 μL
264 μL
MagMAX™ CORE Proteinase K
10 μL
132 μL
Total Bead/PK Mix
30 μL
Table 1. Preparation of the Magnetic Beads and Proteinase K
Note
The manufacturer recommends that you prepare new Bead/PK mix for each processing run. If necessary, the Bead PK mix can be stored at 4 °C for up to 1 week.
Prepare the Lysis Solution.
Combine the following components for the required number of samples plus 10%.
A
B
C
Component
Volume per sample
Volume for 12 reactions + 10%
MagMAX™ CORE Lysis Solution
450 μL
5,940 μL
VetMAX™ Xeno™ Internal Positive Control DNA
4 μL
52.8 μL
Total Lysis Solution and Internal Positive Control DNA
454 μL
Table 2. Preparation of the Lysis Solution
Note
Validation of the protocol used 4 µL VetMAX™ Xeno™ Internal Positive Control DNA per reaction instead of the 2 µL as noted in the manufacturer's protocol for consistency with prior manual extraction methods. Laboratories may choose to validate the use of 2 µL VetMAX™ Xeno™ Internal Positive Control DNA per reaction internally.
Mix by inverting the tube or bottle at least 10 times.
Note
(Optional) Store Lysis Solution at room temperature for up to 24 hours.
Prepare the Deep Well Sample and Wash Plate According to the indicated positions in the instructions and Table below
Add 30 µL of the bead mix to Row A of the Deep Well plate
Add 500 µL of MagMax Core Wash Solution 1 to Row B of the Deep Well plate
Add 500 µL of MagMax Core Wash Solution 2 to Row C of the Deep Well plate
In Row H, place a KingFisher™ Duo 12-tip comb, (ThermoFisher Scientific, cat#97003500)
A
B
C
D
Row ID
Row in the Plate
Reagent
Volume per well
Sample
A
Bead mix
30 μL
Wash 1
B
MagMAX™ CORE Wash Solution 1
500 μL
Wash 2
C
MagMAX™ CORE Wash Solution 2
500 μL
Tip Comb
H
Place a tip comb in the plate
Table 3. Plate setup for the KingFisher™ Duo Prime instrument
Add 90 µL the MagMAX™ CORE Elution Buffer to the Elution strip.
To a microcentrifuge tube, add 1 mL of feces-PBS slurry from Sample Preparation step 7.
Pipetting the Feces-PBS slurry to a microcentrifuge tube.
Centrifuge the sample at 100 x g, Room temperature, 00:01:00
1m
Transfer 200 µL of the supernatant of the fecal slurry to a fresh 1.5 mL microcentrifuge tube.
Add 454 µL of the Lysis solution from step 11.
Vortex vigorously for00:03:00 or until the sample is suspended.
Note
Optional - The sample in the microcentrifuge tube can be placed in a vortexer with Qiagen (MoBio) Vortex Adapter (Cat#13000-V1-24)
3m
Centrifuge the sample at 15000 x g, Room temperature, 00:02:00
2m
Without disturbing the pellet, transfer 200 µL of the the supernatant (clarified lysate) to row A of the Deep Well plate and mix by pipetting up an down several times.
Incubate the clarified lysate and bead mix for 00:02:00 at Room temperature .
2m
Add 350 µL of MagMAX™ CORE Binding Solution to the clarified lsate-bead mixture in Row A.
Immediately proceed to processing the samples on the instrument by placing the Deep Well plate and the Elution strip in the KingFisher™ Duo Prime instrument
Processing on the machine takes approximately 27 minutes.
27m
After samples have finished processing, place a cap on the elution strip and proceed with PCR or store samples at 4 °C until ready to perform PCR.
PCR Method - Setting up and running the PCR reactions
The probe is labeled with FAM with Black Hole Quencher 1 (BHQ1) so detection parameters appropriate for FAM or SYBR should be used.The developing laboratory uses Applied Biosystems™ VetMAX™ Xeno™ Internal Positive Control DNA (ThermoFisher Scientific A29762 or A29764) and the VetMAX™ Xeno™ Internal Positive Control - VIC™ Assay (ThermoFisher Scientific A29765 or A29767) to monitor for PCR inhibition.
Note
Threshold is set at 0.2.
Create run on ABI 7500 Fast machine. Setting up the ABI 7500 Fast Thermocycler: Refer to the manual provided for running the machine. Reaction times are as follows in Table 1.
Equipment
7500 Fast Real-Time PCR System, desktop
NAME
Applied Biosystems
BRAND
4351107
SKU
A
B
C
D
E
F
Stage
Function
Temperature
Duration (sec)
Repeats
Optics
Reverse Transcription
50°C
300
Stage 1
Initial PCR Activation
95.0°C
20
Off
Stage 2
Annealing
95.0°C
3
Repeats 45 times
Off
Stage 2
Extension
60°C
60
On
Table 4a. PCR amplification conditions in ABI 7500 under standard conditions are as follows:
A
B
C
D
E
F
Stage
Function
Temperature
Duration (sec)
Repeats
Optics
Reverse Transcription
50°C
300
Stage 1
Initial PCR Activation
95.0°C
20
Off
Stage 2
Annealing
95.0°C
3
Repeats 45 times
Off
Stage 2
Extension
60°C
60
On
Table 4b. PCR amplification conditions in ABI 7500 under FAST conditions are as follows:
Note
Passive reference dye should be set as ROX
Calculate the number of PCR reactions to be performed. Using Table 2 as a guide, determine the quantity of each reagent needed. Include a positive (C. jejuni ATCC 33291, ATCC 33292, or ATCC 33560) and negative (E. coliATCC 25922) control and a “No Template” negative control.
For calculations, reference Table 5. PCR Worksheet for Reagent Volumes for Master Mix Preparation for Campylobacter jejuni PCR.
Table 5. PCR Worksheet for Reagent Volumes for Master Mix Preparation for Campylobacter jejuni PCR.xlsx
Combine reagents except for the DNA template in a 1.5ml or 2ml microcentrifuge tube and mix well.
Aliquot 18 µL into each PCR tube or reaction well if using a plate.
Add samples and positive (C. jejuni ATCC 33291, ATCC 33292, or ATCC 33560 DNA) and negative (E. coli ATCC 25922 DNA) controls along with PCR inhibition controls VetMAX Xeno Internal Positive Control NDThermo Fisher ScientificCatalog #A29762/A29764.
Place Samples in thermocycler and perform run.
Following run, analyze the results. Results should be reported with a Ct value and interpretation.
Samples with a Ct value of 40 or less should be interpreted as positive. Samples with a Ct value >40 or an undetermined Ct value should be considered negative.