Dec 14, 2024

Public workspaceExtended NET-seq Protocol

PLOS One
Peer-reviewed method
DOI
https://dx.doi.org/10.17504/protocols.io.bp2l6dd91vqe/v1
  • mcconaha Huffines1,
  • David Schneider1
  • 1University of Alabama at Birmimgham
David Schneider
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.bp2l6dd91vqe/v1
External link: https://doi.org/10.1371/journal.pone.0315595
Protocol Citation: mcconaha Huffines, David Schneider 2024. Extended NET-seq Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.bp2l6dd91vqe/v1
Manuscript citation:
Huffines AK, Schneider DA (2025) Differential impact of divalent metals on native elongating transcript sequencing (NET-seq) protocols for RNA polymerases I and II. PLOS ONE 20(2). doi: 10.1371/journal.pone.0315595
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 07, 2024
Last Modified: December 14, 2024
Protocol Integer ID: 115324
Keywords: rna recovery, rna, using saccharomyces cerevisiae, seq protocol, saccharomyces cerevisiae with an emphasis, seq, detailed protocol for net
Funders Acknowledgements:
National Institutes of Health
Grant ID: GM140710
Abstract
Here we provide a detailed protocol for NET-seq using Saccharomyces cerevisiae with an emphasis on examining the effects of divalent cations on RNA recovery.
Troubleshooting
Cell growth and harvest
Streak and grow desired Saccharomyces cerevisiae (yeast) strain on a plate.
Inoculate a starter culture (Amount25 mL -Amount40 mL ) and grow overnight to saturation at Temperature30 °C with nutation.

Overnight
Temperature
Using saturated starter culture, inoculate Amount1 L of YEPD media and grow culture at Temperature30 °C with nutation until A600 = 0.3.

Temperature
Meanwhile, set up glass collection apparatus by nesting a glass funnel with a fritted filter into a Amount1 L Erlenmeyer flask with a side arm.

Once cells have reached A600 = 0.3, place a 0.45 μm Cellulose Nitrate Membrane Filter (GE Healthcare – Whatman, #7184-009) on top of the glass funnel and connect vacuum tubing to the flask. Turn the vacuum on.
Using a clip, secure a glass collection cup on top of the glass funnel.
Quickly pour the entire Amount1 L culture into the collection cup and allow all media to filter into the bottom flask, leaving behind a layer of yeast cells on top of the filter.

Using a flamed and freshly sterilized metal spatula, quickly scrape the yeast cells off the filter.
Submerge the spatula with the scraped cells into a conical containing liquid nitrogen.
Flash freeze cells for approximately Duration00:01:00 -Duration00:02:00 and use another flamed and freshly sterilized metal spatula to scrape the cells off the first spatula and into the conical.

Screw the cap onto the conical, but do not tighten.
Carefully invert conical to remove excess liquid nitrogen.
Store frozen cells at Temperature-80 °C until ready for use.

Note
These cells can be stored for many weeks or months in the freezer as long as they have not been lysed


Cell lysis (with Mikro-Dismembrator II)
Collect dry ice into a cooler.
Dispense liquid nitrogen into a small cryogenic bowl with a wire cage nested inside.
Place a clean and fully dried plastic grinding cup containing a metal ball inside the wire cage and fully submerge the grinding cup in the liquid nitrogen.
After approximately Duration00:03:00 -Duration00:05:00 , transfer the entire yeast sample immediately from the freezer into the cold grinding cup.

Submerge the grinding cup in the liquid nitrogen for Duration00:01:00 .

Using a Mikro-Dismembrator II, lyse cells at maximum speed (16 mm) for Duration00:01:00 .

Once time has elapsed, remove the grinding cup from the machine and submerge in liquid nitrogen for Duration00:01:00 .

Repeat steps 19 and 20 for a total of 10 lysis/rest cycles. Go to

After lysis is complete, remove the grinding cup from the liquid nitrogen and use a flamed and freshly sterilized metal spatula to scrape the lysed cells from the cup into a conical placed on dry ice (note – record the weight of the grindate by weighing the conical before and after scraping the cells into it).
Store lysed cells at Temperature-80 °C (grindates should be used within 24-48 hours of lysis).

Temperature
Cell lysis (with CoolTeenPrep adapter)
Collect dry ice into a cooler.
Label, weigh, and record weights of empty TeenPrep Lysing Matrix A (15 mL) conicals and place on dry ice.
Transfer frozen yeast cell pellet into labelled TeenPrep conicals and return to dry ice.
Load the CoolTeenPrep adapter with dry ice (according to manufacturer’s instructions).
Place sample tubes (make sure to balance the tubes inside the adapter similar to loading a centrifuge) and secure adapter in the FastPrep.
Lyse cells for Duration00:01:00 .

Remove tubes from adapter and let them rest on dry ice for one minute.
Repeat steps 29 and 30 for a total of 5 lysis/rest cycles. Go to

After lysis is complete, weigh tubes containing samples and record weights.
Label 50 mL conicals (one per sample) and dump as much of sample/bead mixture into conical

Note
This step is optional, but it can help to avoid sample loss during resuspension with lysis buffer during step 48 of the “Immunoprecipitation and RNA Extraction” section.

Optional
Store lysed cells (either just the 15 mL conical or the 15 mL + 50 mL conicals if including step 33) at Temperature-80 °C (grindates should be used within 24-48 hours of lysis).

Temperature
Blocking beads for immunoprecipitation
One day prior to following the protocol in the “Immunoprecipitation and RNA extraction” section, block Pierce Anti-HA magnetic beads (ThermoFisher Scientific, #88836) DurationOvernight using the steps below.

Overnight
Prepare the appropriate amount of 1X lysis buffer (Amount4 mL per sample; 10X lysis buffer recipe in S1 Table and 1X lysis buffer recipe in S2 Table) and 1X blocking buffer (Amount0.5 mL per sample; S3 Table) needed based on the number of samples. Add water first, then the rest of the reagents in the order listed in the tables below.


AB
Final Concentration
Tris-HCl, pH 7.9200 mM
Triton X-100 (Sigma, #T8787-100ML)4%
NP-40 (Sigma, #NP40S-100ML)1%
Sterile MilliQ Water up to volume
S1 Table. 10X lysis buffer (can be prepared ahead of time and stored at room temperature).


AB
Final Concentration
10X Lysis Buffer Stock (Table S1)10%
NH4Cl 100 mM
Halt Protease Inhibitor (ThermoScientific, #78430)1%
EDTA, pH 8.5 5 mM
RiboLock RNase Inhibitor (ThermoFisher, #EO0382)25 U/mL
Sterile MilliQ Water up to volume
S2 Table. 1X lysis buffer with EDTA included (freshly prepared for each experiment).

AB
Final Concentration
10X Lysis Buffer Stock (Table S1)10%
NH4Cl 100 mM
Halt Protease Inhibitor (ThermoScientific, #78430)1%
EDTA, pH 8.5 5 mM
RiboLock RNase Inhibitor (ThermoFisher, #EO0382)25 U/mL
BSA10 mg/mL
Sterile MilliQ Water up to volume
S3 Table. 1X blocking buffer (freshly prepared for each experiment).

Mix the lysis and blocking buffers vigorously and then place on ice.
Mix
Add the appropriate amount of Pierce Anti-HA magnetic beads ((grindate weight calculated after lysing cells * 5) * (0.04)) to a low-retention tube for each sample.
Place tubes onto a magnetic tube rack to collect the beads on the side of the tubes for approximately Duration00:00:30 .

Remove the buffer from each tube, quickly resuspend the beads in each tube in Amount1 mL of 1X lysis buffer, and place tubes on ice.

Wash beads at Temperature4 °C for Duration00:02:00 with inversion on a tube rotator.

Wash
Repeat steps 39-41 for a total of 3 washes. Go to

After completing 3 washes, place the tubes onto a magnetic tube rack for approximately Duration00:00:30 .

Remove the buffer from each tube, then resuspend beads in each tube in Amount0.5 mL of 1X blocking buffer.

Incubate the tubes with the beads overnight at Temperature4 °C with inversion on a tube rotator.

Overnight
Temperature
Immunoprecipitation and RNA Extraction
Prepare the appropriate amount of
  • 1X lysis buffer with EDTA (Amount5 mL * grindate weight for each sample; S2 Table) for the untreated samples,
  • 1X lysis buffer without EDTA (Amount5 mL * grindate weight for each sample; S4 Table) for CaCl2, CaCl2 + MNase, MnCl2, and MnCl2 + DNase I samples,
  • and 1X wash buffer (Amount4 mL per sample; S5 Table).
Add water first, then add the rest of the reagents in the order they are listed in the tables. Mix lysis and wash buffers well and place on ice.


AB
Final Concentration
10X Lysis Buffer Stock (Table S1)10%
NH4Cl100 mM
Halt Protease Inhibitor (ThermoScientific, #78430)1%
iboLock RNase Inhibitor (ThermoFisher, #EO0382)25 U/mL
Sterile MilliQ Water up to volume
S4 Table. 1X lysis buffer without EDTA (freshly prepared for each experiment).

AB
Final Concentration
10X Lysis Buffer Stock (Table S1)10%
KCl 300 mM
EDTA, pH 8.5 50 mM
RiboLock RNase Inhibitor (ThermoFisher, #EO0382)25 U/mL
BSA2 mg/mL
Sterile MilliQ Water up to volume
S5 Table. 1X wash buffer (freshly prepared for each experiment)

Mix
Quickly dissolve grindate in appropriate amount of 1X lysis buffer (with EDTA for the untreated samples and without EDTA for the 4 sets of samples subjected to treatment; Amount5 mL * grindate weight calculated after lysis) while samples are on ice.

Use a glass pipet to stir the grindate and pipet up and down to thoroughly dissolve cells in lysis buffer.
Repeat steps 48 and 49 to completely resuspend all samples in 1X lysis buffer while incubating on ice. Go to

For the untreated samples, proceed directly to step 52. For CaCl2 and CaCl2 + MNase treated samples, proceed to “CaCl2 and CaCl2 + MNase Samples” section below. For MnCl2 and MnCl2 + DNase I treated samples, proceed to “MnCl2 and MnCl2 + DNase I Samples” section below.
CaCl2 and CaCl2 + MNase Samples:
  1. With samples on ice, add CaCl2 at a final concentration of 5 mM to both the CaCl2 and CaCl2 + MNase treated samples and mix well.
  2. Add MNase (Worthington, #LS004797) at a final concentration of 100 U/μL to CaCl2 + MNase treated samples only and mix well.
  3. Incubate both CaCl2 and CaCl2 + MNase treated samples at Temperature37 °C for Duration00:02:00 .
  4. Add EDTA (pH 8.5) at a final concentration of 5 mM to both the CaCl2 and CaCl2 + MNase treated samples and mix well. Place samples on ice.
  5. Proceed to step 52.


Incubation
Mix
Temperature
MnCl2 and MnCl2 + DNase I Samples:
  1. With samples on ice, add MnCl2 at a final concentration of 10 mM to both the MnCl2 and MnCl2 + DNase I treated samples and mix well.
  2. Add DNase I (NEB, #M0303L) at a final concentration of 100 U/mL to the MnCl2 + DNase I treated samples only and mix well.
  3. Incubate both the MnCl2 and MnCl2 + DNase I treated samples on ice for Duration00:20:00 .
  4. Add EDTA (pH 8.5) at a final concentration of 5 mM to both the MnCl2 and MnCl2 + DNase I treated samples and mix well. Place samples on ice.
  5. Incubate both the MnCl2 and MnCl2 + DNase I treated samples on ice for Duration00:30:00 .
  6. Proceed to step 52.


Incubation
Mix
Aliquot each sample into pre-chilled low retention tubes and spin samples at Centrifigation16.873 x g, 4°C, 00:15:00
Centrifigation
Collect the supernatant for each sample into 1 conical per sample and place on ice.
Place tubes containing the Anti-HA magnetic beads and blocking buffer (blocked overnight at Temperature4 °C ) onto the magnetic tube rack and let beads settle to the side of each tube for approximately Duration00:00:30 .

Remove the blocking buffer from each tube.
Resuspend the beads for each sample in Amount1 mL of sample lysate and transfer the beads + Amount1 mL lysate back to the sample conical (beads and lysate will now be in the same conical).

Repeat step 56 for each sample until the beads have been incorporated into each sample conical.
Incubate samples for Duration03:00:00 at Temperature4 °C with inversion on a tube rotator.

Incubation
Temperature
After three hours, remove the tubes and place on ice.
Aliquot each sample into pre-chilled low retention tubes.
Place tubes on the magnetic tube rack, allowing beads to settle to the side of each tube for approximately Duration00:00:30 .

Discard the supernatant from each tube and resuspend beads in Amount1 mL of 1X wash buffer.

Wash beads for each sample for Duration00:02:00 at Temperature4 °C with inversion on a tube rotator.

Wash
Repeat steps 61-63 for a total of four washes. Go to

After the final wash, place the tubes on the magnetic tube rack and allow beads to settle to the side of each tube for approximatelyDuration00:00:30 .

Discard the wash buffer from each tube and resuspend the beads for each sample in Amount500 µL of TES (10 mM Tris-HCl (pH 7.5), 1 mM EDTA (pH 8.5), 1% SDS).

Add Amount500 µL of phenol ((pH 4.3) Fisher, #BP1751I-400) to each tube and vortex to mix.

Mix
Centrifuge samples at Centrifigation17.000 x g, 00:05:00 at room temperature.

Centrifigation
Transfer the aqueous layer for each sample to a new tube.
Repeat steps 67-69 until 2 total phenol extractions and 2 total chloroform extractions have been completed. Go to

After the final chloroform extraction, transfer the aqueous layer into a new tube.
Prepare a glycoblue solution in a new tube with a 1:5 ratio of GlycoBlue Coprecipitant (Invitrogen, #AM9515) to sterile MilliQ water.
Add Amount10 µL of the glycoblue solution (from step 72) to each sample.

Add Amount1.4 mL ammonium acetate precipitation solution (1 M ammonium acetate, 95% ethanol) to each sample.

Precipitate samples at Temperature-80 °C overnight or longer (can precipitate samples for weeks or even months).

Overnight
Temperature
Linker ligation, enzymatic linker digestion, and zinc fragmentation
Centrifuge sample tubes at Centrifigation16.873 x g, 4°C, 01:00:00

Centrifigation
After spin, remove tubes and discard all of the precipitation solution (taking care not to disturb the RNA pellet at the bottom of the tube).
Add Amount750 µL of 75% ethanol to each tube.

Centrifuge samples at Centrifigation17.000 x g, 00:02:00 at room temperature.

Centrifigation
Repeat steps 76-78 until two total ethanol washes have been completed.
After the final wash, carefully remove the ethanol and leave the caps of the tubes open until all remaining residual ethanol has evaporated.
Dissolve RNA pellets in Amount11.5 µL of 10 mM Tris-HCl (pH 6.9) - only need Amount10 µL of sample for linker ligation reaction but will use ~Amount1.5 µL of sample to check the RNA concentration.

Using a nanodrop, determine the RNA concentration and quality of each sample.
Make the ligation mix without the linker (will add this after denaturing) by adding the reagents in the order they are listed in the table (S6 Table), scaling up based on the number of samples. Place the mix on ice. The sequence of the UMI linker is included in S12 Table.

AB
1X
50% PEG, MW 8000 (NEB, #B1004S)4.8 μL
10X T4 RNA Ligase Buffer (NEB, #B0216S)2 μL
20 µM UMI Linker 1 μL
RiboLock RNase Inhibitor (ThermoFisher, #EO0382)0.5 μL
Sterile MilliQ Water0.7 μL
Total Volume 9 μL
S6 Table. Ligation mix for a single sample.

Mix ligation mix vigorously.
Mix
Add the appropriate amount of the UMI linker to a PCR tube.
Denature the UMI linker for Duration00:03:00 at Temperature80 °C , then immediately place on ice.

Temperature
After denaturing, add the entire amount of the denatured UMI linker to the ligation mix and thoroughly mix.
Mix
Transfer each RNA sample (Amount10 µL ) to a new PCR tube.

Denature the RNA samples for Duration00:02:00 at Temperature80 °C , then immediately place the tubes on ice or onto a chilled tube rack.

Add Amount9 µL of the ligation mix to each sample and mix well.

Mix
Add Amount1 µL of T4 RNA Ligase 2, truncated (NEB, #M0242L) to each sample and mix well.

Mix
Incubate samples at Temperature25 °C for Duration03:00:00 .

Incubation
After 3 hours have elapsed, add Amount2 µL of 5’ Deadenylase (NEB, #M0331S) to each sample and mix well.

Mix
Incubate samples at Temperature30 °C for Duration00:45:00 .

Incubation
Dilute samples 2.5X with sterile MilliQ water supplemented 0.6X with NEBuffer 2 (NEB, #B7002S). Therefore, for a sample volume of Amount22 µL in volume, add Amount19.8 µL of NEBuffer 2 and Amount13.2 µL of sterile MilliQ water. Mix well.

Mix
Add Amount2 µL of RecJf (NEB, #M0264L) to each sample and mix well.

Mix
Incubate samples at Temperature37 °C for Duration00:45:00 .

Incubation
Add Amount2.2 µL of fragmentation solution (100 mM Tris-HCl (pH 6.9), 100 mM ZnCl2) to each sample and mix well.

Mix
Incubate samples at Temperature70 °C for Duration00:16:00 .

Incubation
After fragmentation is complete, immediately place tubes on ice or onto a chilled tube rack.
Add Amount2.5 µL of 200 mM EDTA (pH 8.5) to each sample and mix well.

Mix
Transfer samples to a new tube, then add Amount1 µL glycoblue and Amount360 µL of ammonium acetate precipitation solution (see recipe in “Immunoprecipitation and RNA Extraction” section) to each sample.

Precipitate samples at Temperature-80 °C overnight or longer (can precipitate samples for weeks or even months).

Overnight
Reverse transcription and size selection
Centrifuge sample tubes at Centrifigation16873 x g, 4°C, 01:00:00

Centrifigation
After spinning, discard the remaining ammonium acetate precipitation solution from each sample tube (being careful not to disturb the pellet at the bottom of the tube).
AddAmount750 µL of 75% ethanol to each sample, then centrifuge samples at Centrifigation17000 x g, 00:02:00 at room temperature.

Centrifigation
Repeat steps 105 and 106 until a total of 2 ethanol washes have been completed. Go to

Wash
After removing the ethanol from the second wash, leave the caps of the tubes open to allow for the residual ethanol to completely evaporate from the pellet.
Dissolve pellets in Amount10 µL of 10 mM Tris-HCl (pH 6.9).

Prepare the reverse transcription and the RNasin/DTT mixes by adding reagents in the order that they are listed in the tables (S7 and S8 Tables), scaling up based on the number of samples. Place the mixes on ice. The oligo sequence for the NET2 primer is included in S12 Table.

AB
1X
5X First Strand Buffer (Included in Superscript III Kit)3.28 μL
10 mM each dNTPs (ThermoFisher, #R0181)1.64 μL
10 µM NET2 Primer 0.5 μL
Total Volume 5.42 μL
S7 Table. Reverse transcription mix for a single sample.

AB
1X
RiboLock RNase Inhibitor (ThermoFisher, #EO0382)0.25 μL
100 mM DTT (Included in Superscript III Kit) 0.82 μL
Sterile MilliQ Water 0.25 μL
Total Volume 1.32 μL
S8 Table. RNasin/DTT mix for a single sample.

Mix the reverse transcription mix vigorously, then transfer Amount5.4 µL to one PCR tube per sample.

Mix
Add the entire Amount10 µL of each sample to PCR tubes (one sample per tube) and mix well to incorporate samples with the reverse transcription mix.

Mix
Incubate samples at Temperature65 °C for Duration00:05:00 .

Incubation
Temperature
Immediately place the tubes on ice or onto a chilled tube rack.
Mix the RNasin/DTT mix vigorously, then add Amount1.32 µL to each sample and mix well.

Mix
Add Amount0.82 µL of Superscript III Reverse Transcriptase (Invitrogen, #56575) to each sample and mix well.

Mix
Incubate samples at Temperature45 °C for Duration00:30:00 .

Incubation
Temperature
AddAmount1.8 µL of 1 M NaOH to each sample and mix well.

Mix
Incubate samples at Temperature98 °C for Duration00:20:00 .

Incubation
Temperature
After reverse transcription is complete, combine samples with Amount20 µL of loading dye (90% formamide, 25 μM EDTA (pH 8.5), 0.025 μg/μL Bromophenol Blue).

Heat samples at Temperature100 °C for Duration00:05:00 .

Temperature
Load samples (leaving an entire well blank between samples or loading only loading dye into the wells between samples) onto a 10% polyacrylamide gel and run the gel at 700V for approximately Duration01:00:00 .

Stain the gel with Amount100 mL of staining solution (SYBR Gold (Invitrogen, S11494) diluted 1:10,000 with 1X TBE) at room temperature for Duration00:20:00 with rotation.

Meanwhile, use a sterilized 20G needle to poke a hole in the bottom of a 0.5 mL tube and nest the tube inside of a 1.5 mL tube (prepare one nested tube inside a larger tube per sample).
After staining, image gel.
Use sterile razorblades to excise samples from the gel between 120 bp (large primer band will be located just below this) and 600 bp.
Once a sample has been excised from the gel, place it into the appropriately labelled nested tube. Repeat steps 126 and 127 for all samples. Go to

Centrifuge the samples at Centrifigation17.000 x g, 00:03:00 at room temperature.

Centrifigation
Transfer any gel pieces that remain in the nested tube into the bottom tube after the spin for each sample.
Add Amount500 µL of sterile MilliQ water to each sample.

Incubate samples at Temperature-80 °C for Duration00:15:00 .

Incubation
Temperature
Incubate samples at Temperature70 °C for Duration00:15:00 .

Incubation
Temperature
Incubate samples at Temperature30 °C with rotation DurationOvernight .

Incubation
Overnight
Temperature
The next day, use a mini centrifuge to collect the gel slurry at the bottom of the tubes.
Transfer the gel slurry for each sample into a Costar Spin-X centrifuge tube filter (Corning, #8160).
Centrifuge samples at Centrifigation17000 x g, 00:03:00 at room temperature.

Centrifigation
Discard the gel pieces collected in the top filter for each sample.
Transfer the liquid sample from the bottom of the tube into a new tube for each sample.
Add Amount32 µL of 3 M NaCl to each sample.

Add Amount940 µL of 100% isopropanol to each sample.

Add Amount1 µL of glycoblue to each sample.

Precipitate samples at Temperature-80 °C overnight or longer (can precipitate samples for weeks or even months).

Overnight
Temperature
Circularization and library amplification/preparation for sequencing
Centrifuge sample tubes at Centrifigation16873 x g, 4°C, 01:00:00

Centrifigation
Remove and discard the ammonium acetate precipitation solution from all samples (being careful not to disturb the pellet at the bottom of the tube).
Add Amount750 µL of 75% ethanol and centrifuge samples at Centrifigation17000 x g, 00:02:00 at room temperature.

Centrifigation
Repeat steps 144-145 until pellets have been washed with 75% ethanol for a total of 2 times.Go to

Wash
After the final wash, remove the ethanol and leave the caps of the tubes open to allow for all residual ethanol to evaporate.
Dissolve the pellets in Amount15 µL of 10 mM Tris-OAc (pH 7.9).

Prepare the circularization mix by adding the reagents in the order they are listed in the table (S9 Table), scaling up based on the number of samples. Mix well, then place mix on ice.

AB
1X
10X Circularization Buffer (Included in CircLigase Kit)2 μL
1 mM ATP (Included in CircLigase Kit)1 μL
500 mM MnCl2 (Included in CircLigase Kit)1 μL
Total Volume 4 μL
S9 Table. Circularization mix for a single sample.

Mix
Add Amount4 µL of the circularization mix to one PCR tube per sample.

Add the entire sample (Amount15 µL ) to each PCR tube (one sample per tube) and mix well.

Add Amount1 µL of CircLigase ssDNA Ligase (Biosearch Technologies, #CL4111K) to each sample and mix well.

Incubate samples at Temperature60 °C for Duration01:00:00 .

Incubation
Temperature
Add an additional Amount1 µL of CircLigase ssDNA Ligase to each sample and mix well.

Incubate samples at Temperature60 °C for Duration01:00:00 .

Incubation
Temperature
Incubate samples at Temperature80 °C for Duration00:10:00 .

Incubation
Temperature
Transfer circularized DNA to a new tube for storage (circDNAs are very stable and excess sample can be stored at Temperature-20 °C long-term).

Prepare the phusion master mix by adding the reagents in the order they appear in the table (S10 Table), scaling up based on the number of samples. Mix well and place mix on ice. The Phusion polymerase was previously purified by our lab in-house.

AB
1X
5X HF Phusion Buffer (ThermoScientific)16.7 μL
10 mM each dNTPs (ThermoFisher, #R0181)1.7 μL
Phusion Polymerase 0.8 μL
Sterile MilliQ Water 58.4 μL
Total Volume 77.6 μL
S10 Table. Phusion master mix for a single sample.

For each sample, make a unique library amplification mix by combining Amount77.6 µL of phusion master mix + Amount0.8 µL forward primer + Amount0.8 µL reverse primer (see S13 Table for forward and reverse primer sequences).

Mix
Add Amount1 µL of circularized DNA of each sample to a PCR tube.

To each sample, add Amount16.7 µL of the unique library amplification mix and mix well.

Mix
Use a thermal cycler to amplify libraries based on the cycle provided in S11 Table (25 amplification cycles total). Set lid temperature to Temperature105 °C .

ABC
StepTemperatureDuration
198°C0:30
298°C0:10
360°C0:10
472°C1:00
5GOTO step 224X
64°C∞
S11 Table. Library amplification cycle protocol.

After amplification, use PCRClean DX Beads (Aline, #C-1003-5) to prepare samples for sequencing by following the manufacturer’s protocol exactly.

AB
Sequence
20 μM UMI Linker (IDT)5rApp/CANNNNNNNNCTCCACGAGTCATCCGC/3ddc/
10 μM NET2 Primer (IDT)5Phos/CTGTAGGCACCATCAATGATCGTCGGA/isp18/CACTCA/isp18/CGTCTCTTCTGCGGATGACTCGTGGAG
S12 Table. Oligo sequences for the UMI linker and reverse transcription primer.

ABC
SampleForwardReverse
Untreated 1CAAGCAGAAGACGGCATACGAGATttctgcctTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
Untreated 2CAAGCAGAAGACGGCATACGAGATgctcaggaTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
Untreated 3CAAGCAGAAGACGGCATACGAGATaggagtccTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
CaCl2 1CAAGCAGAAGACGGCATACGAGATgctcaggaTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
CaCl2 2CAAGCAGAAGACGGCATACGAGATaggagtccTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
CaCl2 3CAAGCAGAAGACGGCATACGAGATcatgcctaTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
CaCl2 + MNase 1CAAGCAGAAGACGGCATACGAGATgtagagagTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
CaCl2 + MNase 2CAAGCAGAAGACGGCATACGAGATcctctctgTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
CaCl2 + MNase 3CAAGCAGAAGACGGCATACGAGATagcgtagcTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
MnCl2 1CAAGCAGAAGACGGCATACGAGATgtagagagTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
MnCl2 2CAAGCAGAAGACGGCATACGAGATcctctctgTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
MnCl2 3CAAGCAGAAGACGGCATACGAGATagcgtagcTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
MnCl2 + DNase 1CAAGCAGAAGACGGCATACGAGATcagcctcgTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
MnCl2 + DNase 2CAAGCAGAAGACGGCATACGAGATtgcctcttTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
MnCl2 + DNase 3CAAGCAGAAGACGGCATACGAGATtcctctacTCCGACGATCATTGATGGTGCCAATGATACGGCGACCACCGAGATCTACACtagatcgcCGTCTCTTCTGCGGATGACTCG
S13 Table. Oligo sequences for library amplification indices for each sample.

AB
SoftwareVersion
FastQC0.11.7
fqtrim0.9.7
cutadapt3.4
Anaconda5.3.1
STAR2.7.1a
SAMTools1.6
BEDTools2.28.0
R4.0.2
RStudio1.3.959
dplyr1.1.10
plyr1.8.7
ggplot23.3.6
ggseqlogo0.1
ggpubr0.4.0
cowplot1.1.1
matrixStats0.61.0
hexbin1.28.2
tweedie2.3.5
statmod1.4.36
magritter2.0.3
scales1.2.1
tidyr1.2.1
1.2.11.8-11
DiffLogo2.14.0
rclone1.48.0
RcppRoll0.3.0
S14 Table. R packages and versions used in data analysis.