Mar 11, 2024
Exposure to Bisphenol-A and Melatonin altered the Expression of Estrogen and Androgen Receptors in Neonatal Female rats
- Eniola Risikat Kadir1
- 1University of Ilorin, Ilorin, Nigeria
Protocol Citation: Eniola Risikat Kadir 2024. Exposure to Bisphenol-A and Melatonin altered the Expression of Estrogen and Androgen Receptors in Neonatal Female rats. protocols.io https://dx.doi.org/10.17504/protocols.io.261gedqryv47/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 06, 2024
Last Modified: March 11, 2024
Protocol Integer ID: 96406
Keywords: androgen receptors in neonatal female rat, neonatal female rat, androgen receptor, exposure to bisphenol, melatonin, hormonal assay, estrogen, bisphenol, expression of estrogen, biochemical assay, breeding of animal, rat
Abstract
This protocol details about grouping and breeding of animals, sample collection and processing, hormonal assay, biochemical assay and quantitative real-time polymerase chain reaction procedure.
Attachments
py6hccsw7.pdf
117KB
Guidelines
The animals are treat humanely with regard to following the standard guidelines for use and care of experimental animals. The research obtained a protocol approval from theUniversity of Ilorin, Ilorin, Nigeria by the Ethical Review Committee (UERC/ASN/2018/1154). This research was conducted in the Animal Holding of the College of Health Sciences, University of Ilorin.
Grouping and breeding of animals
Note
- Procure bisphenol A and sesame seed oil from Sigma (CAS –No: 80-05-7), Germany, also, purchase absolute ethanol and melatonin from a standard laboratory in Ilorin.
- Purchase the animals from an animal breeding farm in Oyo State, Nigeria for the experiment. Mature female rats weighing 150 ± 10g and male rats weighing 200g ± 20g. Maintain animals in a controlled environment, with a 12-hour day and night schedule. They have access to water and chow rat-mouse diet freely.
Cage adult male wistar rats of proven fertility overnight with females in proestrous phase of the cycle.
Gestational Day 1 (GD 1) is the day detect sperm cells in the vagina. Once pregnancy is confirmed, isolate the pregnant rat in a cage to stay until parturition, with a total of 12 pregnant females being used for the study.
After parturition, recognise and group the female litters . These are the second-generation Wistar rats. They have daily subcutaneous injections from post-natal day 0 for four days (PND 0 - 3). The seven groups are administered as follows:
- I – Normal saline
- II – sesame oil and ethanol (vehicle)
- III - melatonin only (10mg/kg)
- IV – 25mg/kg BPA
- V – 25mg/kg BPA + melatonin (10mg/kg)
- VI –50mg/kg BPA
- VII – 50mg/kg BPA + melatonin (10mg/kg).
Perform all administrations in the morning, and allow all the groups to mature till adulthood day 120 ± 3 days, when they are sacrificed in the morning, between 7 a.m. and 9 a.m.
Sample collection and processing
After administration of BPA and melatonin treatments, the animals are left until day 120 ± 4 days. They are euthanised by administration of 20 mg/kg body weight of ketamine intramuscularly.
Following the incision and lateral reflection of the scalp, expose the skull promptly with tissue forceps to extract the entire brain and pinpoint, collect, and place the hypothalamus, situated alongside the pituitary gland at the floor of the sella turcica) into cryovials preloaded with RNA, then they are subsequently kept frozen in liquid nitrogen tanks.
The harvested brains are the nutilized for genetic (RNA) studies. Additionally, collect the female gonads; the left ovary are for follicular count on histology, which is fixed for 48 hours in 4% paraformaldehyde, and the right ovary of each animal is homogenized in 0.25 Molarity (M) ice-cold phosphate buffer followed by centrifugation of homogenates for enzyme studies.
Perform staining of the ovarian tissues in paraffin wax embedded sections according to Canene-Adams, 2013 and Haematoxylin and Eosin staining by the protocols outlined by Fischer et al., 2008. The various follicles (primary, secondary, preantral, antral, and corpora lutea are identified, counted then recorded.
Hormonal Assay
15m
Obtain the blood samples from the apex of the heart for hormonal analysis using 5 mL needles and syringes.
Centrifugation for 3000 rpm, 00:15:00 is used to separate the serum.
15m
Assay plasma luteinizing hormone, follicle stimulating hormone, oestrogen, progesterone, testosterone, and Anti-Mullerian Hormone concentration measurements using the Enzyme-Linked Immunosorbent Assay (ELISA) technique and purchase ELISA kits from Monobind Inc. Lake Forest, USA, following manufacturer's guide.
Biochemical assay
5m
Note
Assess Nitric oxide levels following the method outlined by Montgomery and Dymock in 1961.
This involved measuring the levels in an acidic environment, where use nitrite, upon formation, to create nitrous acid, which react with sulfanilamide to form a product. This resulting product is then coupled with N-(1-naphthyl) ethylenediamine, to give an azo dye displaying a vibrant reddish-purple color, quantifiable at 540 nm.
Note
Determine the activity of Glutathione peroxidase (GPx) using the method outlined by Paglia and Valentine, 1967.
A unit of GPx activity is defined as the enzyme quantity necessary to catalyze the oxidation of 1 nanomolar (nM) NADPH per minute at 25 °C .
Note
The assessment of Superoxide dismutase (SOD) is carried out following the method detailed by Nishikimi et al. in 1972.
The SOD enzyme's capability to impede the phenazine methosulfate-mediated reduction of nitro-blue tetrazolium dye is measured by monitoring absorbance at 560 nm over a 00:05:00 period at 25 °C .
5m
Quantitative real-time polymerase chain reaction procedure
15m
Euro Gold Tri-Fast solution (Euro Clone) is used to prepare the RNA.
The tissue is then pulverized using a tissue homogenizer, followed by DNase treatment on the extraction samples of total RNA, such that DNA contamination from the total RNA prepared could be eliminated.
Purification (through acid phenol-chloroform), precipitation, and suspension of the RNA in distilled water (dH2O) are then carried out.
The reverse transriptase enzyme (Invitrogen) is used for reverse transcription of total RNA, using M-MLV reverse transcriptase (Invitrogen), which involves retrotranscription of 1 µg of total RNA to quantify mRNA expression in experiments.
A gently mixing of the samples through up and down pipetting and then incubate at 37 °C . M-MLV RT is inactivated for 00:15:00 at 70 °C . Keep cDNA at -20 °C .
15m
NanoDrop™ 1000 spectrophotometer is used to measure cDNA and RNA concentrations.
Nucleic acid quality is noted via absorbance ratios at 260 nm/280 nm and 260 nm/230 nm.
Measurement of the relative amounts of the transcript of a specific gene is performed using a qRT-PCR, via a two-step procedure using:
- Sybr green supermix (Biorad)- the amplification reaction and generation of melting curves of the amplicons subsequently.
- Verification of the melting curve data is running through the PCR product on 2% agarose gel.
The efficiency of the Primer is tested in reactions with six serial 1:10 dilutions of cDNA as a template to perform a calibration curve.
| A | B | C | D | E | |
| Primers | Sequence | Expected Product (bp) | |||
| 1 | Nuclear receptor 1I3 (NR1I3, CAR) | ||||
| RT-mCAR-DIR | GCCATGGCTCTCTTCTCTCC | 160 | |||
| RT-mCAR-REV | CTAGCAGGCCCATCAGCTTT | ||||
| 2 | Androgen receptor (Ar) | ||||
| RT-mAr-DIR | CAGGGACCACGTTTTACCCA | 229 | |||
| RT-mAr-REV | TTTCCGGAGACGACACGATG | ||||
| 3 | Anti-mullerian hormone receptor (Amhr) | ||||
| mAmh-DIR | CTGGGAGCAAGCCCTGTTAG | 180 | |||
| mAmh-REV | GGTTGAAGGGTTAGGGCGAG | ||||
| 4 | KISS1 receptor (Kiss1r) | ||||
| mKiss1r-DIR | GCTAGTCGGGAACTCACTGG | 120 | |||
| mKiss1r-REV | ACGCAGCACAGAAGGAAAGT | ||||
| 5 | Gonadotropin-releasing hormone 1 (Gnrh1) | ||||
| mGnrh1-DIR | TGGTATCCCTTTGGCTTTCACA | 192 | |||
| mGnrh1- REV | GATCCTCCTCCTTGCCCATC | ||||
| 6 | Gonadotropin releasing hormone receptor (Gnrhr) | ||||
| mGnrhr-DIR | GCCTCAGCCTTGTCTCATGT | 140 | |||
| mGnrhr-REV | TATGTTGGGCTTTCCCGGTC | ||||
Data analysis
Collect the data and analyze by two-way analysis of variance (ANOVA) and subsequently subjecte to Tukey’s (HSD) test of multiple comparison using GraphPad Prism v.6 (GraphPad Software, Inc., La Jolla, CA, USA).
- Express data as means ± SEM (standard error of mean).
- Statistical significance is taken as P value less than 0.05 (p<0.05).