Mar 26, 2026
ETS-guided iPSC-endothelial models
- François Korbmacher1
- 1European Molecular Biology Laboratory (EMBL), Barcelona
Protocol Citation: François Korbmacher 2026. ETS-guided iPSC-endothelial models. protocols.io https://dx.doi.org/10.17504/protocols.io.5qpvoedw7l4o/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 23, 2026
Last Modified: March 26, 2026
Protocol Integer ID: 313716
Keywords: endothelial cells with elevated barrier function, differentiation into brain microvascular endothelial cell, primary human brain endothelial cell, derived endothelial cell, improved endothelial identity, brain microvascular endothelial cell, endothelial differentiation, ets transcription factor, inducible ets transcription factors etv2, endothelial identity, endothelial model, recognition of ets transcription factor, generation of the transgenic cell line, human ipsc cell line, transgenic cell line, pluripotent stem cell, generating transcription factor, cells with mixed epithelial identity, transposon system into the genome, transcription factor, mixed epithelial identity, primary brain ec, elevated barrier function, enhanced barrier function
Funders Acknowledgements:
Marie Skłodowska-Curie Actions COFUND
Grant ID: 847543
Abstract
Induced pluripotent stem cell (iPSC) differentiation into brain microvascular endothelial cells (iBMECs) with elevated barrier function often result in cells with mixed epithelial identity. Given the increasing recognition of ETS transcription factors in endothelial differentiation, we generated a stable iPSC line expressing the DOX-inducible ETS transcription factors ETV2, FLI1, and ERG, resulting in cells with improved endothelial identity and enhanced barrier function compared to primary human brain endothelial cells (primary brain ECs).
The approach is implemented by generating transcription factor constructs under a Tet-one inducible system which will be integrated via piggybac transposon system into the genome of the human iPSC cell line: IMR90-4 (WiCell).
In this protocol, we outline the generation of the transgenic cell line and guide through the differentiation to obtain iPSC-derived endothelial cells with elevated barrier function.
Materials
| A | B | C | |
| Reagent/Resource | Reference or Source | Identifier or Catalog Number | |
| Experimental Models | |||
| iPS(IMR90)-4 | WiCell | WISCi004-B | |
| Recombinant DNA | |||
| Plasmid: MultiSite Gateway Pro pDONR P5-P2 | ThermoFisher | Cat#12537 | |
| Plasmid: MultiSite Gateway Pro pDONR P1-P5r | ThermoFisher | Cat#12537 | |
| Plasmid: piggyBac vector | (Woltjen et al, 2009) | N/A | |
| Antibodies | |||
| Mouse monoclonal anti-CD31, PE conjugated | BD Pharmingen | Cat#560983; RRID: AB_395839 | |
| Rabbit monoclonal anti-ETV2 | abcam | Cat#EPR5229; RRID: AB_181847 | |
| Rabbit monoclonal anti-ERG | abcam | Cat#EPR3864; RRID: AB_92513 | |
| Rabbit polyclonal anti-FLI1 | abcam | Cat#/RRID: AB_153909 | |
| Mouse monoclonal anti-EpCAM | Biolegend | Cat#324202; RRID: AB_756076 | |
| Mouse polyclonal anti-ZO-1 | Invitrogen | Cat#40-2200; RRID: AB_2533456 | |
| Rabbit monoclonal anti-beta-catenin | Cell Signaling | Cat#9587; RRID: AB_10695312 | |
| Mouse monoclonal anti-PAR-1, AF488 conjugated | R&D Systems | Cat#FAB3855G; RRID: AB_3649778 | |
| Mouse monoclonal anti-ICAM1 | abcam | Cat#ab20; RRID: AB_445260 | |
| Alexa Fluor 647 Phalloidin | ThermoFisher | Cat#A22287 | |
| DAPI | ThermoFisher | Cat#D21490 | |
| Chemicals, Enzymes and other reagents | |||
| Geneticin | Gibco | Cat#10131035 | |
| Puromycin dihydrochloride from Streptomyces alboniger | MERCK | Cat#P8833 | |
| BlasticidinS HCl | ThermoFisher | Cat#R21001 | |
| Matrigel Growth Factor Reduced | Corning | Cat#45356231 | |
| mTeSR-1 Kit | StemCell | Cat#85850 | |
| Y-27632 | StemCell | Cat#72304 | |
| DMEM/F-12 | Gibco | Cat#11320033 | |
| Knockout Serum Replacement | Gibco | Cat#10828028 | |
| Glutamax | Gibco | Cat#13462629 | |
| MEM Non-Essential Amino Acids Solution | Gibco | Cat#11350912 | |
| ß-mercaptoethanol | Sigma | Cat#21985023 | |
| human endothelial serum-free medium | Gibco | Cat#11111044 | |
| Human serum from platelet poor plasma | Sigma | Cat#P2918 | |
| Recombinant Human FGF | R&D Systems | Cat#233-FB-010 | |
| all-trans-Retinoic acid | Sigma | Cat#R2625 | |
| Doxycycline | Stemcell | Cat#100-1047 | |
| Accutase | Gibco | Cat#A1110501 | |
| Collagen from human placenta | Sigma | Cat#F1141 | |
| Fibronectin bovine plasma | Sigma | Cat#C5533 |
| A | B | C | |
| Other | |||
| LightCycler 480 II | Roche | Cat#05015278001 | |
| Amaxa 4D-Nucleofector protocol | Lonza | Cat#V4XP-3032 |
Troubleshooting
Generation of ETS-transcription factor inducible iPSCs (IMR90-4)
ETS-transcription factor gene products ETV2 (1089 bp), FLI1 (1417 bp) and ERG (1521 bp)
The aim of this step is to generate PCR fragments of the required transcription factors that are flanked with integration regions for the MultiSite Gateway Pro system (ThermoFisher). The protocol follows the manufacturers instruction for 2-fragment recombination. Below we highlight the specific requirements for the generation of Tet-One inducible ETS-transcription factor constructs for piggybac integration.
Primers are designed for cDNA in the longest isoform of each gene:
Primer table 1
| Fwd_ETV2 | atggacctgtggaactgggatgag | |
| Rev_ETV2 | ttattgtgtctctgctccccgtccg | |
| Fwd_FLI1 | atggacgggactattaaggaggctc | |
| Rev_FLI1 | gtagtagctgcctaagtgtgaagg | |
| Fwd_ERG | atgattcagactgtcccggacccag | |
| Rev_ERG | ttagtagtaagtgcccagatgagaag |
The primers have to be flanked with the following flanking regions according to MultiSite Gateway Pro system.
Needed flanking regions
| GGGGACAAGTTTGTACAAAAAAGCAGGCT | attB1 | |
| GGGGACAACTTTTGTATACAAAGTTG | attB5r | |
| GGGGACAACTTTGTATACAAAAGTTG | attB5 | |
| GGGGACCACTTTGTACAAGAAAGCTGGGT | attB2 | |
| GGGGACCACTTTGTACAAGAAAGCTGGGTA | attB2 v5 |
the overall primer design will requires:
- 60bp
- Kozak sequence (GCCACC) before start codon
- e.g. B5-kozak-atg(longest isoform)-stop-b2
- for adding tac remove stop codon and use attB2v5
Therefore, the following set of primers will be used downstream it integrate the changes:
Primer table 2
| A | B | |
| attB5 FLI1 | GGGGACAACTTTGTATACAAAAGTTGCCACCatggacgggactattaaggaggctctgtc | |
| FLI1 attB2 V5 | GGGGACCACTTTGTACAAGAAAGCTGGGTAgtagtagctgcctaagtgtgaaggcacgtg | |
| attB5 ETV2 | GGGGACAACTTTGTATACAAAAGTTGCCACCatggacctgtggaactgggatgaggcatc | |
| ETV2 attB2 | GGGGACCACTTTGTACAAGAAAGCTGGGTttattgtgtctctgctccccgtccgcctccc | |
| attB5 ERG | GGGGACAACTTTGTATACAAAAGTTGCCACCatgattcagactgtcccggacccagcagc | |
| ERG attB2 | GGGGACCACTTTGTACAAGAAAGCTGGGTttagtagtaagtgcccagatgagaaggcata |
PCR
For template amplification, the following PCR steps are recommended:
| A | B | C | D | |
| volume | PCR programm | time (mm:ss) | ||
| 2xKOd Xtreme buffer | 25ul | 94 °C | 1:00 | |
| dNTP | 10ul | 98 °C | 0:10 * | |
| Fw | 1.5ul | 58/56 °C | 0:30 * | |
| Rev | 1.5ul | 68 °C | 2:00 * times 40 | |
| template approx 200ng | 1ul (cDNA) | 68 °C | 1:00 | |
| H2O | 10ul | 12 °C | infit. | |
| Enzyme | 1ul |
- Run PCR with oligos from primer table 1 for optimized primer annealing on human cDNA to generate gene templates.
- Check a fraction of product on 1% agarose gel for expected sizes (ETV2: 1089 bp, FLI1: 1417 bp, ERG: 1521 bp).
- Run PCR with oligos from primer table 2 on your PCR product from above.
- Check product on 1% agarose gel.
- Cut products from gel and extract with a extraction method of choice.
This step of the protocol generates the fused plasmids carrying the Tet-one inducible transcription factors. The aim is to generate one construct per transcription factor by using destination vectors carrying different drug resistances (e.g., puromycin, neomycin, Blas), a 1-5r entry clone carrying the Tet-one expression system and the 5-2 entry prepared above (see table below). Follow the MultiSite Gateway Pro system (ThermoFisher) according the manufacturers instructions for 2-fragment recombination.
In brief:
MultiSite Gateway BP Recombination
Premix for each transcription factor construct:
- attB PCR (15-150ng) -> 1ul
- pDONR 5-2 (150ng/ul) -> 0.5 ul
- 1 x TE buffer -> to 4 ul
+ BP clonase -> 1 ul -> mix and incubate 1h @ RT
- Transform 1,5 ul of recombination mix with competent bacteria of choice.
- Plate out on KAN Agar plates and let colonies grow over night.
- Sanger Sequence picked colonies with M13 fwd/M13 rev primers and check for the correct gene integration (see plasmid maps).
MultiSite Gateway Pro LR recombination reaction
Recombination strategy
| A | B | C | D | |
| destination vector | entry clone 1 | entry clone 2 | contains resistance | |
| PB puro v5 "pless ANK121 v5 PBpuro" | Tet on 1-5r | FLI1 5-2 | AMP resistance | |
| PB neo "pless ANK121 neo" | Tet on 1-5r | ERG 5-2 | AMP resistance | |
| PB Blas "pless ANK121 blas" | Tet on 1-5r | ETV2 5-2 | AMP resistance |
For reaction: 0.5 ul of each component + 2.5 ul EB buffer/ TE buffer = 4 ul total
- premix all in tube
- LR clonase, thaw on ice
- add 1 ul LR clonase and flip
- @ RT for > 16 hours (better approx 20h)
Transform 2 ul of LR reaction into competent bacteria and plate on AMP agar plates, for overnight growth. Pick from each plate at least two colonies, and let them grow in a overnight culture in LB. Perform Mini prep plasmid purification. Check plasmids for purity on a 1% agarose gel.
The generate plasmids are attached to this protocol as plasmid maps.
Electroporation of iPSC-line IMR90-4 (WiCell)
The aim of this step is to simultaneously electroporate the three recombinant vectors from above into IMR90-4 iPSCs using the Amaxa 4D-Nucleofector Basic Protocol for Human Stem Cells (Lonza Cat#V4XP-303).
Prepare constructs:
- 0.5 ug of construct
- 0.5 ug of pcA6 PBase (piggy bac vector)
- always add equal amount of construct and PBase, don't exceed 1 ug.
for 3 plasmids: 0.25 ug + 0.25 ug + 0.25 ug + 0.25 ug of PBase
Prepare cells:
- remove media, wash with PBS
- add 0.5 ml Accutase @ 37 degrees for 5-7 minutes
- wash off with 0.5 media (without aspirating Accutase) and transfer into 1.5 ml tube
- keep 10 ul for cell count
- approx. 2.0 x 10^6 cells / transfection are needed
- prepare required cell number in tube and spin 3 minutes @ 1000 rpm, remove SN, spin again 20 sec w/o media, remove last drops
Electroporation:
- resuspend cells in 20 ul /electroporation in P3 primary cell buffer (e.g. for 3 transfections in 60 ul buffer)
- singularize cells by pipetting, resuspend DNA in cells and add 20 ul into cuvette
- load cuvette, and electroporate in primary cell p3 program.
- remove cuvette carefully and add 80 ul media (w/o Rock inhibitor) into cuvette well
- plate cells in coated 12-well dish with Rock inhibitor. Add 100 ul of transfection, wash cuvette with media.
- check well on microscope and put in incubator.
Let the electroporated cells grow 48-72 hour post nucleofection, and observe morphological recovery.
Drug selection of electroporated cells
In this step, cells integrating the three plasmids will be drug selected. For this, it is essential, that the lowest drug concentration for killing wild type iPSCs has been previously identified (kill-curve).
Drug selection can be performed as combined selection (all three drugs at once) or cycled selection (recommended). It is recommended to start with the selection at day 2 or 3 post nucleofection with 50 % of the final kill curve dose. In the next few days, the dose is being ramped up. Usually cell passaging induces a lot of killing of non-resistant cells.
When normal growth is being observed after drug selection, clones can be established.
Establishing clones
After drug selection, observe pluripotent-typic morphology in the colonies.
- Accutase detach cells and singularize by pipetting. Seed single cells in laminin coated dish of choice at very low seeding density with rock inhibitor. Let single cells grow to round colonies that are still well separated.
- For colony picking, wash plate with DPBS and detach with 0.5mM EDTA. With a microscope in a cell culture hood, pick half detached colony with pipet tip, aspirate and transfer to eppendorf tube containing 200 ul of media. Pick several clones.
- Seed the picked colonies on new plates (initially 12- or 24 well plates recommended) and let the clones grow.
Differentiation to endothelial cells
Differentiation is performed following the iBMEC-like protocol in 5% O2 hypoxia (Park et al., 2019) including DOX induction at day 6:
1) At day -3 iPSCs are seeded as single cells on Matrigel-coated 6-well plates in mTeSR1 with 10 μM Y-27632.
2) At day -2 and -1 the cells are maintained in mTeSR1 only.
3) Equally distributed colonies are exposed to unconditioned medium (UM) from day 0 until day 5 with daily media changes, containing: 39.25 mL DMEM/F12 (Invitrogen) with 10 mL Knockout Serum Replacement (Gibco), 0.25 mL Glutamax (Invitrogen), 0.5 mL non-essential amino acids (Invitrogen) and 0.35 μL ß-mercaptoethanol (Sigma) at 5% O2.
4) Endothelial expansion and transcription factor upregulation are performed at day 6 for two days in filter sterilized human endothelial serum-free medium (hESFM, Invitrogen), with 1% plasma-derived serum (Sigma), 20 ng/mL hFGF (R&D Systems), and 10 μM retinoic acid (Sigma). Endothelial differentiation is promoted through the addition of 100 ng/mL doxycycline to the same endothelial media
composition.
5) At day 8, the generated cells are accutase-released, passaged for one hour on 80 µg/ml collagen and 20 µg/ml fibronectin-coated wells, gently PBS washed and used for further assays after additional accutase detachment.
6) Cell can be seeded into various 80 µg/ml collagen and 20 µg/ml fibronectin-coated setups like normal dishes, microfluidic setups or 3D setups like hyrdogel, etc. Important is to keep the DOX in media until d11, at which endothelial identity is fully acheived.
Endothelial identity and ETS-transcription factor expression can be approved for instance by immunofluorescence assays with antibodies listed in Materials.
TNFα stimulation can be performed at 10 ng/mL for 18 hours. Mycoplasma tests are recommended
biweekly.
Protocol references
Lippmann ES, Azarin SM, Kay JE, Nessler RA, Wilson HK, Al-Ahmad A, Palecek SP, Shusta EV (2012) Derivation of blood-brain barrier endothelial cells from human pluripotent stem cells. Nature biotechnology 30: 783-791
Prk T-E, Mustafaoglu N, Herland A, Hasselkus R, Mannix R, FitzGerald EA, Prantil Baun R, Watters A, Henry O, Benz M (2019) Hypoxia-enhanced Blood-Brain Barrier Chip recapitulates human barrier function and shuttling of drugs and antibodies. Nature communications 10: 2621
Lu TM, Houghton S, Magdeldin T, Durán JGB, Minotti AP, Snead A, Sproul A, Nguyen D-HT, Xiang J, Fine HA (2021) Pluripotent stem cell-derived epithelium misidentified as brain microvascular endothelium requires ETS factors to acquire vascular fate. Proceedings of the
National Academy of Sciences 118: e2016950118
Woltjen K, Michael IP, Mohseni P, Desai R, Mileikovsky M, Hamalainen R, Cowling R, Wang W, Liu P, Gertsenstein M et al (2009) piggyBac transposition reprograms fibroblasts to induced pluripotent stem cells. Nature 458: 766-770
Korbmacher F, Fleckenstein H, Long R, Poliński P, Piatti L, López-Gutiérrez B, Batzilla A, Crusius D, Trivedi V, Ebisuya M, Bernabeu M. (2025) ETS-guided iPSC-endothelial models recapitulate malaria pathogenesis. bioRxiv. 2025 Jul 2:2025-07.
Acknowledgements
We want to thank Mitsuhiro Matsuda for the support and mentoring with the stem cell technologies.