Nov 23, 2023
  • 1University of California, San Diego
Icon indicating open access to content
QR code linking to this content
Protocol CitationChien-Ju Chen, Kian Kalhor, Kun Zhang 2023. Enzymatic padlock probe preparation. protocols.io https://dx.doi.org/10.17504/protocols.io.n92ldm3pxl5b/v1
Manuscript citation:
Kalhor, K., Chen, CJ., Lee, H.S. et al. Mapping human tissues with highly multiplexed RNA in situ hybridization. Nat Commun 15, 2511 (2024). https://doi.org/10.1038/s41467-024-46437-y
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 20, 2023
Last Modified: November 23, 2023
Protocol  Integer ID: 83659
Keywords: enzymatic padlock probe preparation, enzymatic padlock probe preparation this protocol, multiplexed rna in situ hybridization, preparation of padlock probe, steps for the enzymatic amplification, padlock probe, enzymatic amplification, multiplexed rna, unlimited source of padlock probe, thousands of padlock probe, individual synthesis of probe, situ hybridization, manuscript mapping human tissue, pcr amplification upon need, pcr amplification, probe, probe set
Abstract
This protocol accompanies the manuscript Mapping Human Tissues with Highly Multiplexed RNA in situ Hybridization (https://doi.org/10.1101/2023.08.16.553610). It protocol outlines the steps for the enzymatic amplification and preparation of padlock probes from an oligo pool. This strategy has a lower upfront cost compared to individual synthesis of probes and thus permits the use of tens of thousands of padlock probes per probe set. Additionally, the oligo pool serves as an unlimited source of padlock probes, as it can be expanded by PCR amplification upon need.
Materials
Reagents

MaterialSupplierCatalog number
KAPA SYBR FAST qPCR kitRocheKK4602
Glycoblue Coprecipitant (15mg/mL)ThermoFisher ScientificAM9515
Sodium Acetate (3M), pH 5.5, RNase-freeInvitrogenAM9740
Lambda Exonuclease 1,000UNEBM0262S
USERNEBM5505L
DpnIINEBR0543L
Novex TBE-Urea Sample Buffer (2X)ThermoFisher ScientificLC6876
SYBR GoldInvitrogenS11494
Nanosep Columns; 0.2 um filterVWR29300-646
QIAquick PCR purification kitQiagen28104
ssDNA/RNA clean & concentrator kitZymo ResearchD7011
Ammonium persulfateSigma-AldrichA3678
TEMEDFisher Scientific17919
40% Acrylamide/ Bis solution (29:1)Fisher ScientificBP1408-1
Primers
Primer nameVendorSequenceUsage
pAP1V41UIDTG*T*AGACTGGAAGAGCACTGTU Amplification of kidney probe set
AP2V4IDT/5Phos/TAGCCTCATGCGTATCCGAT Amplification of kidney probe set
AP1V7UIDTA*A*GCAAGATTCTCGTCGAG/3deoxyU/Amplification of brain probe set
AP2V7IDT/5Phos/TGTAAGGCACATCTCGGATCAmplification of brain probe set
RE_DpnII_V7NIDTGCACATCTCGGATCNNNNAmplification of brain probe set

Before start
The main starting material is an oligo pool with probe-set specific amplification primers on the 5' and 3' ends. In the example below, AP1V7 and AP2V7 are the primer pair that specifically amplify our probe set of interest.
oligo pool pre-amplification
Resuspend the oligo pool in water to a concentration of 7.02 ng/uL. Dilute the pool 100 times and run PCR to amplify the brain probe set.

reagents1x volume (ul)
100x diluted oligo pool5
10uM AP1V7U primer2
10uM AP2V7 primer2
2x KAPA SYBR FAST qPCR master mix25
ultrapure water16

PCR program:
95 °C , 00:00:30 -> (95 °C , 00:00:30 ->55 °C 00:00:45 ->72 °C 00:00:45 )x17 cycles ->72 °C , 00:02:00 -> 15 °C , hold
4m 30s
Purify the PCR product by QIAquick PCR purification kit and elute each QIAquick column with 50 µL ultrapure water

Use Qubit with HS dsDNA kit to quantify the concentration and dilute the PCR product to 10nM by adding ultrapure water. This is called "10nM oligo pool 1st amplicon" in the following section.
PCR mass production
50m
Prepare PCR production mix in a 15mL tube and add load 100 µL to each well of a 96-well plate

reagents1x volume (ul)100x volume (ul)
10nM oligo pool 1st amplicon0.220
2x KAPA SYBR FAST qPCR master mix505000
100uM AP1V7U primer0.440
100uM AP2V7 primer0.440
ultrapure water494900
run PCR program to amplify the oligo pool
98 °C , 00:01:00 -> (98 °C , 00:00:30 ->55 °C 00:00:45 ->72 °C 00:00:45 )x14 cycles ->72 °C , 00:02:00 -> 4 °C , hold

5m
Pool the PCR production mix from the 96-well plate and prepare the ethanol precipitation mix in 5mL-tubes. (One 96-well plate can split into 8 5mL-tubes)

reagents1x volume
PCR product1200
100% ethanol3000
glycoblue coprecipitant4
3M NaOAc120
Mix the tubes by shaking and incubate them in a -80 °C freezer for 01:00:00 .
Centrifuge the tubes at 4,000rpm, 4 °C for 00:30:00 and discard the supernatant
1h 30m
Add 800 µL 80% ethanol to each 5mL tube and transfer the solution into another 1.5mL tube. (8 5mL-tubes transfer into 8 1.5mL tubes).
Centrifuge at 14,000rpm, 4 °C for 00:05:00 and discard the supernatant.
5m
Air-dry the DNA pallets on ice bucket in AirClean hood for 00:10:00
Rehydrate DNA pallets with 50 µL ultrapure water
Pool the DNA solutions and use 8 QIAquick columns to purify.
Use Nanodrop to quantify the concentration.
Aliquot 3uL for TBU gel check
10m
Lambda Exo digestion
2h
Prepare Lambda Exo digestion mix and split it into PCR tubes (100 µL per tube). Adjust the volume of DNA amplicon and ultrapure water so that the DNA amplicon per tube is around 5 µg

reagents1x volume (ul)16x volume (ul)
DNA amplicon25400
10x Lambda Exo buffer10160
Lambda Exo (5U/uL)10160
ultrapure water55880
Run PCR program: 37 °C ,02:00:00 ->4 °C ,hold

2h
Use 16 ssDNA/RNA Zymo-spin columns to purify the Lambda Exo-digested products and elute the columns with 50 µL ultrapure water
Use Nanodrop to quantify the concentration.
Aliquot 3uL for TBU gel check
USER digestion
3h
Prepare USER digestion mix and split into PCR tubes (80 µL per tube). Adjust the volume of ssDNA and ultrapure water so that the ssDNA per tube is less than 2 µg .

reagents1x volume (ul)12x volume (ul)
ssDNA66.7800
USER (1U/uL)560
10x DpnII buffer896
ultrapure water0.34
Run PCR program: 37 °C ,03:00:00 ->4 °C ,hold.
Aliquot 3uL for TBU gel check
3h
DpnII digestion
5h 5m
Prepare DpnII oligo mix and add 15 µL to each PCR tube
reagents1x volume (ul)12x volume (ul)
10x DpnII buffer224
100uM RE_DpnII_V7N primer560
ultrapure water896
Run PCR program: 94 °C ,00:02:00 -> 37 °C ,00:03:00 -> 4 °C , hold

5m
Add 5 µL DpnII enzyme (10U/uL) to each PCR tube (total volume is 100 µL per tube) and mix by pipetting.

Run PCR program:37 °C ,05:00:00 ->4 °C , hold

5h
Use ssDNA/RNA Zymo-spin columns to purify each PCR tube and elute each column with 50 µL ultrapure water
Use Nanodrop to quantify the concentration
Aliquot 3uL for TBU gel check

TBU gel check (optional)
30m
Pre-run one 12-well TBU-gel for at least 00:10:00

Prepare TBU gel check samples
sampleinput (ul)ultrapure water (ul)2x Novex buffer (ul)
10 bp DNA ladder145
1: PCR product145
2: Lambda Exo145
3: Lambda Exo +USER145
4: Lambda Exo +USER +DpnII145
Notes: If PCR product and Lambda Exo sample look overloaded, dilute the sample by 10-20 times before TBU gel check.

Incubate TBU gel check samples at 70 °C for00:05:00 and immediately put on ice for 00:05:00

Flush each well with TBE running buffer to remove excessive urea in the 12-well gel

Load the TBU gel check samples to the 12-well TBU gel

Run gel electrophoresis at 220-240 V for 00:20:00
Example TBU gel for a padlock probe set with the final size of 150nt:


40m
Size selection
2h 51m
Pre-run 1-well TBU gels for at least 00:10:00

Prepare enzyme-digested probes: add 180 µL 2x Novex buffer to 180 µL enzyme-digested probes

Incubate the samples at 70 °C for 00:05:00 and immediately put on ice for 00:05:00

Flush each well with TBE buffer to remove excessive urea in each well.
20m
Load samples to 1-well TBU gel.

Notes: Cap the amount of enzyme-digested probes per 1-well TBU gel at 2 µg to avoid overloading and add the equivalent volume of 2x Novex buffer. The rest of the enzyme-digested probes can be stored at -20 °C freezer for the next round of size selection.

Run gel electrophoresis at 220-240 V for 00:20:00

20m
Cut enzyme-digested probes at the right size and transfer the cut-out gels to 0.5mL tubes (with holes at the bottom) on top of 2mL tubes

Centrifuge the tubes at 15,000rpm for 00:05:00 to shred gels

Transfer the remaining gel in the 0.5mL tubes to the 2 mL tubes
5m
Add 450 µL 1x TE buffer, pH 8.0 to each 2mL tubes and mix the tubes by shaking

Freeze and thaw the solution in the -80 °C freezer, Overnight and vortex the tubes in a 37 °C incubator for 02:00:00

2h
Centrifuge the tubes at 15,000rpm, Room temperature for 00:03:00

Transfer the clear supernatant to Nanosep columns and centrifuge at 15,000 rpm, Room temperature for 00:03:00

Repeat Nanosep filtering once and transfer the flow-through to 1.5 mL tubes

6m
Ethanol precipitation
1h 45m
Add 1 mL 100% ethanol , 1.4 µL glycoblue coprecipitant , 45 µL 3M NaOAc, pH 5.2 to each tube and mix by shaking
Precipitate probes in a -80 °C freezer for at least 01:00:00

Centrifuge at 10,000 rpm, 4 °C for 00:30:00 and discard the supernatant

1h 30m
Wash the pallets with 750 µL cold 80% ethanol and centrifuge at 14,000rpm at 4 °C for 00:05:00

5m
Discard the supernatant and air-dry the pallets in AirClean hood for 00:10:00

10m
Rehydrate the pallets with 10 µL ultrapure water per tube and pool the probe solution together

Use Qubit with ssDNA kit to quantify the concentration of probe solution