Apr 20, 2026

Environmental Surveillance Protocols for Highly Pathogenic Avian Influenza (HPAI) V.1

  • Govindhaswamy Umapathy1,
  • Aruna Panda1,
  • Gayatri Divakar1,
  • Abhilash Nair1,
  • Mamidala Srilakashmi1
  • 1CSIR- Centre for Cellular and Molecular Biology
Icon indicating open access to content
QR code linking to this content
Document CitationGovindhaswamy Umapathy, Aruna Panda, Gayatri Divakar, Abhilash Nair, Mamidala Srilakashmi 2026. Environmental Surveillance Protocols for Highly Pathogenic Avian Influenza (HPAI). protocols.io https://dx.doi.org/10.17504/protocols.io.81wgbw1bogpk/v1Version created by Govindhaswamy Umapathy
License: This is an open access  document  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Created: April 13, 2026
Last Modified: April 20, 2026
Document  Integer ID: 314904
Keywords: environmental surveillance protocols for highly pathogenic avian influenza, systematic environmental surveillance for avian influenza virus, surveillance protocols for highly pathogenic avian influenza, monitoring of avian influenza virus, highly pathogenic avian influenza, avian influenza virus, characterisation of influenza virus, protocol for influenza, avian flu, influenza virus, extracted influenza, human influenza, air samples from poultry farm, rad cfx96 systems for rna, advanced molecular detection method, influenza, nucleic acid extraction from air sample, quantitative reverse transcription pcr on bio, sequencing adapter, whole genome sequencing from rna, nucleic acid extraction from environmental water sample, step reverse transcription quantitative pcr, known rna standard, flu pipeline, genome sequencing, sequencing data, appropriate template rna input, quantitative reverse transcription pcr, protocol for nucleic acid extraction, µl of influenza, rna quantification, wizard enviro total nucleic aci
Funders Acknowledgements:
Gates foundation
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Environmental Surveillance Protocols for Highly Pathogenic Avian Influenza (HPAI)
This comprehensive protocol suite enables systematic environmental surveillance for avian influenza viruses through multi-matrix sampling and advanced molecular detection methods. The protocols encompass collection procedures for water samples from lakes and reservoirs, fecal specimens from poultry and wildlife areas, sediment from migratory bird sites, and air samples from poultry farms using Coriolis µ air samplers. Nucleic acid extraction utilizes the Promega nviro Wizard TNA kit optimized for environmental matrices. Detection employs dual approaches: digital PCR using QIAcuity OneStep Advanced Probe Kit targeting WHO M gene sequences, and quantitative reverse transcription PCR on Bio-Rad CFX96 systems for RNA quantification. For genetic characterization, protocols include influenza A whole-genome sequencing using the Oxford Nanopore Native Barcoding Kit V14.These standardized methods provide robust surveillance capabilities for early detection and monitoring of avian influenza viruses in environmental settings, supporting public health preparedness and wildlife disease management initiatives


Protocols for environmental surveillance for Avian flu.
Protocol for sample collection
A) Sample collection:
Requirements:
● 50ml centrifuge tubes
● 15ml centrifuge tubes
● Viral transport medium (VTM) (Avienbio, India, cat. no. PCM-30001)
● Sterile swabs
● Personal Protective Equipment (PPE)-Disposable gloves, masks and gowns
● 70% ethanol
● Tissue paper
● Discard bag
● Ice box with cold packs
● Coriolis µ air sampler (Bertin technologies, France, cat. no. P001080-CORM0-A) with collection cones of max 15 ml volume.
Procedure:
Water: Collected from lakes, reservoirs and poultry farm water outlets (run off)
● Collect 40 ml of water samples in 50ml centrifuge tubes.
● Wear appropriate PPE during collection. Discard and use new gloves for water collection from different locations.
● Store the water samples in an ice box during transport to maintain the cold chain.
● In the laboratory, immediately store the samples at 4℃ until further processing.
● Before processing, wipe the tubes with 70% ethanol.
.
Fecal: Collected from poultry, lakes and wildlife sanctuaries
● Collect approximately 2g of fecal sample using sterile swab in 15ml centrifuge tubes containing 3ml of viral transport medium.
● Follow the same safety precautions and storage procedures used for water sample collection.
Sediment: Collected from lakes and reservoirs
● Collect at least 2ml of sediment (soil near the periphery of the lakes where migratory birds are seen) in 50ml centrifuge tubes.
● Follow the same safety precautions and storage procedures used for water sample collection.
Air: Collected near poultry farms, migratory bird roosting sites
● Place the air sampler at an appropriate height and distance (within 1 feet of the poultry unit/migratory bird roosting site) from the collection site.
● Add 3-5 ml of phosphate buffered saline (PBS) to the collection cone of the air sampler
● Sterilize the air sampler parts using 70% ethanol between two locations to avoid cross-contamination.
● Store collection cone in the ice box and later at 4℃ until further processing.
Protocol for Nucleic Acid Extraction from Environmental Samples
Nucleic acid extraction from environmental water samples using Promega Enviro Wizard TNA kit (Promega, USA, cat. no. A2991):
 
Requirements:
Instruments/Laboratory ware:
  1. Centrifuge
  1. Minicentrifuge
  1. Water bath
  1. Vacuum pump
  1. Vacuum manifold (e.g., Vac-Man Laboratory Vacuum Manifold, Promega, USA cat. no. A7231)
  1. Eluator Vacuum Elution Device (Promega, USA, cat. no. A1071)
  1. 50ml disposable screw-cap tubes
  1. 1.5 mL microcentrifuge tubes
Reagents:
  1. Isopropanol
  1. Ethanol
  1. Promega - Wizard Enviro Total Nucleic Acid Kit content
o Binding Buffer 1 (BBD)
o Binding Buffer 2 (BBE)
o Protease Solution
o Column Wash 1(CWE)
o Column Wash 2 (RWA)
o Nuclease-Free Water
o PureYield Binding Column (Promega, USA)
o PureYield Minicolumn (Promega, USA)
Capture and Concentration:
  1. Dispense 40ml of the water sample collected into a 50ml centrifuge tube.
  1. Preheat 1.2 ml of Nuclease-Free Water, per sample, to 60°C for 2–5 minutes.
  1. Add 0.5 ml of Protease Solution to each wastewater sample. Mix well by inversion and incubate for 30 minutes at ambient temperature.
  1. Centrifuge at 3,000 × g for 10 minutes to remove solids.
Note: It is important to remove solids to avoid clogging the PureYield Binding Column
  1. Carefully decant the supernatant into a 250ml high density polyethylene (HDPE) bottle. Discard the 50ml collection tube containing the pellet into an appropriate biohazard waste container.
  1. Add 12ml of Binding Buffer 1 (BBD) followed by 1ml of Binding Buffer 2 (BBE). Mix well by inversion.
  1. Add 48ml of isopropanol to each tube. Mix well by inversion.
  1. Prepare the vacuum manifold assembly as described below.
  1. Remove the vacuum port cap. Attach a Reservoir Extension Funnel to the PureYield Binding Column, then connect the column to the vacuum manifold by pressing the nozzle gently into the vacuum port.
  1. Pour the mixture from each tube from Step 7 into the Reservoir Extension Funnel on the PureYield Binding, turn on the pump and apply vacuum to capture TNA on the column.
  1. Add 5ml of Column Wash 1 (CWE) and apply a vacuum to pull the liquid through the PureYield Binding Column.
  1. Add 20ml of Column Wash 2 (RWA) and apply a vacuum to pull the liquid through the PureYield Binding Column. Continue to draw a vacuum for an additional 30 seconds after all visible liquid has passed through the membrane.
  1. Release the vacuum by turning off the vacuum pump and opening ports at unused positions. Remove the column from the vacuum manifold.
  1. Assemble the elution device by placing a 1.5ml microcentrifuge tube into the base of the Eluator Vacuum Elution Device and securing the tube cap in the open position. Insert the PureYield Binding Column into the top of the Eluator Device, making sure the column is fully seated on the collar.
  1. Place the Eluator Device assembly onto a vacuum manifold (Figure 3, Panel B). Add 500μl of preheated (60°C) Nuclease-Free Water to the PureYield Binding Column. Check that the vacuum manifold is properly assembled again (e.g., unused ports are closed) and then apply maximum vacuum for 1 minute or until all liquid has passed through the column. Repeat the process by adding another 500μl of preheated Nuclease-Free Water to the PureYield Binding Column to elute a total of 1ml of TNA solution.
Total Nucleic Acid Extraction and Clean-Up:
  1. Add 400μl of Binding Buffer 1 and 100μl of Binding Buffer 2 to 1ml of liquid eluted in Part-A.
  1. Mix well by inversion and divide the contents into two 1.5ml tubes containing 750μl each.
  1. Add 750μl of isopropanol to each tube and mix well.
  1. Place the PureYield Minicolumn into a PureYield Collection Tube. Pass the entire volume of the mixture through the column, 750μl at a time, using a microcentrifuge set at 10,000rpm for 1 minute or you can alternately use vacuum manifold.
  1. Add 300μl of Column Wash 1 (CWE) and pull through the PureYield Minicolumn by centrifugation. Discard the flowthrough.
  1. Add 500μl of Column Wash 2 (RWA) and pull through the PureYield Minicolumn by centrifugation. Repeat this wash one time. Discard the flowthrough.
  1. Centrifuge for 30 seconds to remove any residual wash solution.
  1. Preheat 50μl of Nuclease-Free Water per sample to 60°C for 2–5 minutes.
  1. Transfer the PureYield Minicolumn to a new 1.5ml microcentrifuge tube and add 30μl of preheated (60°C) Nuclease-Free Water to the column. Let the water soak into the column filter for approximately 1 minute.
  1. Centrifuge at 10,000rpm for 1 minute to elute. Repeat elution with another 30μl of preheated Nuclease-Free Water, for a total of 60μl.
  1. Store sample at or below –20°C until further analysis. TNA purified using this method can be directly used for Reverse transcriptase quantitative Polymerase Chain Reaction (RT-qPCR).
Nucleic acid extraction from fecal and sediment samples using Promega Enviro Wizard TNA kit (Promega, USA, cat. no. A2991):
Requirements:
Same as the protocol for TNA extraction from environmental water samples.
Initial sample volume required: 2ml
A. Capture and Concentration:
  1. To 2ml of solid material (sludge or settled solids) add 8ml of Nuclease-Free Water resulting in a 10ml final volume.
  1. Add 200μl Protease Solution, mix well and incubate for 30 minutes.
  1. Add 3ml of Binding Buffer 1 (BBD) and 250μl of Binding Buffer 2 (BBE).
  1. Add 12ml of isopropanol. Mix well by inversion.
  1. Centrifuge the mixture at 3,000 × g for 10 minutes.
  1. The supernatant will contain nucleic acid from the solids. Add the supernatant to the Reservoir Extension Funnel on the PureYield Binding Column turn on the pump and apply a vacuum to capture the TNA on the column.
  1. Add 5ml of Column Wash 1 (CWE) and apply a vacuum to pull the liquid through the PureYield Binding Column.
  1. Add 20ml of Column Wash 2 (RWA) and apply a vacuum to pull the liquid through the PureYield Binding Column. Continue the vacuum for an additional 30 seconds after all fluid has passed through the membrane.
9. Elute captured nucleic acid using the Eluator Vacuum Elution Device by eluting in 500μl of Nuclease-Free Water, twice, for a total elution volume of 1ml.
Nucleic acid extraction from air samples using Promega Enviro Wizard TNA kit (Promega, USA, cat. no. A2991):
Requirements:
Same as the protocol for TNA extraction from environmental water samples.
Initial sample volume required: 2ml-5ml of PBS (volume left after the air sampling run, where the initial volume was 10ml of PBS)
A. Capture and Concentration:
  1. To remaining volume of PBS in air sampling cone, add in Nuclease-Free Water such that the final volume is 10ml.
2. Further steps are same as that for nucleic acid extraction from fecal and sediment samples.
Note: Protocol for Total Nucleic Acid Extraction and clean-up for fecal, air and sediment is same as that for water samples.
Protocol for Digital PCR using QIAcuity
 
One-step reverse transcription digital PCR (RT-dPCR) for RNA quantification using the QIAcuity OneStep Advanced Probe Kit (QIAGEN, cat. no. 693400) — Single Reaction Protocol
 
Requirements:protocols
 
Instruments/Laboratory ware:
QIAcuity instrument (QIAcuity One, QIAcuity Four, or QIAcuity Eight)
QIAcuity Nanoplate (8.5k 24-well, 8.5k 96-well, or 26k 24-well format as required)
Standard 96-well PCR pre-plate
Thermal cycler (for pre-plate preparation, if applicable)
Microcentrifuge
Vortex mixer
P200, P20, P10, P2 pipettes and appropriate tips
Ice bucket with ice
 
Reagents:
 
Input material:
Template RNA (extracted and quality-assessed; appropriate input amount depends on target concentration and assay sensitivity)
RNase-Free Water
 
QIAcuity OneStep Advanced Probe Kit contents:
4x QIAcuity OneStep Advanced Probe Master Mix
100x OneStep Advanced Reverse Transcription Mix
Enhancer GC (optional; recommended for Applied Biosystems TaqMan assays, amplicons >150 bp, GC-rich amplicons, and RNA targets with challenging secondary structures)
Primers and probes:
 
Component Sequence / Description Final concentration in reaction
WHO M gene forward primer (MP-39-67For) CCMAGGTCGAAACGTAYGTTCTCTCTATC 0.4 µM
WHO M gene reverse primer (MP-183-153Rev) TGACAGRATYGGTCTTGTCTTTAGCCAYTCCA 0.4 µM
WHO M gene probe (MP-96-75ProbeAs) 5'-(HEX)-ATYTCGGCTTTGAGGGGGCCTG-(BHQ)-3' 0.2 µM
 
Note: For multiplex reactions (up to 5 targets), prepare a separate 20x primer–probe mix for each additional target. Refer to the QIAcuity User Manual (www.qiagen.com/HB-2717) for dye channel recommendations.
 
Methodology:
 
A. Reaction Mix Preparation
 
Remove the 100x OneStep Advanced Reverse Transcription Mix from storage and place on ice. Thaw the 4x QIAcuity OneStep Advanced Probe Master Mix, template RNA, primers, probes, and RNase-Free Water at room temperature.
Vigorously vortex the 4x QIAcuity OneStep Advanced Probe Master Mix and all individual solutions to ensure complete mixing. Centrifuge tubes briefly to collect all liquid at the bottom.
Prepare a master mix for a single reaction according to the table below. Select the column corresponding to your Nanoplate format:
 
Component 8.5k Nanoplate (24- or 96-well) 26k Nanoplate (24-well) Final conc.
4x OneStep Advanced Probe Master Mix 3 µl 10 µl 1x
100x OneStep Advanced RT Mix 0.12 µl 0.4 µl 1x
20x primer–probe mix (WHO M gene forward primer + WHO M gene reverse primer + probe) 0.6 µl 2 µl 0.4 µM each primer; 0.2 µM probe
Enhancer GC (optional) 1.5 µl 5 µl
RNase-Free Water To volume To volume
Template RNA (added separately at step A4) Variable Variable
Total reaction volume 12 µl 40 µl
 
Note: For multiplex reactions, add 0.6 µl (8.5k) or 2 µl (26k) of each additional 20x primer–probe mix (targets 2–5), reducing the RNase-Free Water volume accordingly.
Note: Appropriate template RNA input depends on expected target copy number and assay sensitivity. Refer to the QIAcuity User Manual for guidance.
 
Vortex the reaction mix well. Dispense the appropriate volume of reaction mix (without template) into the wells of a standard 96-well PCR pre-plate. The pre-plate may be assembled at room temperature.
Add the template RNA to the wells containing the reaction mix. Mix thoroughly by pipetting up and down.
 
B. Nanoplate Loading and RT-dPCR Run
 
Transfer the contents of each pre-plate well to the corresponding wells of the QIAcuity Nanoplate.
Seal the Nanoplate using the QIAcuity Nanoplate Seal supplied in the QIAcuity Nanoplate Kit. Ensure the seal is applied firmly and evenly across all wells.
Place the sealed Nanoplate into the QIAcuity instrument and start the RT-dPCR programme using the cycling conditions in the table below:
 
Step Time Temperature
Reverse Transcription 40 min 50°C
RT Enzyme Inactivation 2 min 95°C
2-step cycling — 40 cycles
    Denaturation 5 s 95°C
    Combined annealing/extension 30 s 60°C*
 
Note: *Annealing/extension temperature and number of cycles may vary depending on assay type. Optimise as required.
 
C. Data Analysis
 
Once the run is complete, open the results in the QIAcuity Software Suite.
Apply the automated or manual threshold to separate positive from negative partitions for each fluorescence channel.
Review partition images and amplitude plots to confirm clean separation of positive and negative clusters.
Export the absolute quantification results (copies/µl or copies/reaction) as required.
For guidance on data analysis and interpretation, refer to the QIAcuity User Manual (www.qiagen.com/HB-2717) and the QIAcuity User Manual Extension (www.qiagen.com/HB-2839).
 
References:
 
1.    QIAGEN (2022). QIAcuity OneStep Advanced Probe Kit Quick-Start Protocol. HB-3048-003. www.qiagen.com
2.    QIAGEN (2022). QIAcuity User Manual. www.qiagen.com/HB-2717
3.    QIAGEN (2022). QIAcuity User Manual Extension. www.qiagen.com/HB-2839
 Protocol for Quantitative reverse transcription PCR (qRT-PCR) using Bio-Rad CFX96
 
One-step reverse transcription quantitative PCR (RT-qPCR) for RNA quantification using the QIAcuity OneStep Advanced Probe Kit (QIAGEN, cat. no. 693400) on the Bio-Rad CFX96 Touch Real-Time PCR Detection System — Single Reaction Protocol
 
Requirements:
 
Instruments/Laboratory ware:
Bio-Rad CFX96 Touch Real-Time PCR Detection System
Hard-Shell 96-well PCR plates, thin-wall (Bio-Rad, cat. no. HSP9601) or equivalent
Optically clear plate seals (e.g. Bio-Rad Microseal 'B' PCR Plate Sealing Film, cat. no. MSB1001) or equivalent
Microcentrifuge
Vortex mixer
P200, P20, P10, P2 pipettes and appropriate RNase-free tips
Ice bucket with ice
 
Reagents:
 
Input material:
Template RNA
RNase-Free Water
 
QIAcuity OneStep Advanced Probe Kit contents (used for qRT-PCR):
4x QIAcuity OneStep Advanced Probe Master Mix
100x OneStep Advanced Reverse Transcription Mix
Primers and probes:
 
Component Sequence Final concentration in reaction
WHO M gene forward primer (MP-39-67For) CCMAGGTCGAAACGTAYGTTCTCTCTATC 0.4 µM
WHO M gene reverse primer (MP-183-153Rev) TGACAGRATYGGTCTTGTCTTTAGCCAYTCCA 0.4 µM
WHO M gene probe (MP-96-75ProbeAs) 5'-(HEX)-ATYTCGGCTTTGAGGGGGCCTG-(BHQ)-3' 0.2 µM
 
Note: The QIAcuity OneStep Advanced Probe Kit is validated for use with hydrolysis probes. The kit's hot-start RT enzyme allows reactions to be assembled at room temperature. Although originally formulated for digital PCR on QIAcuity instruments, the master mix is compatible with quantitative real-time PCR on the Bio-Rad CFX96 when used with the cycling conditions provided in this protocol.
 
Methodology:
 
A. Reaction Mix Preparation
 
Remove the 100x OneStep Advanced Reverse Transcription Mix from storage and place immediately on ice. Thaw the 4x QIAcuity OneStep Advanced Probe Master Mix, template RNA, primers, probes, Enhancer GC (if using), and RNase-Free Water at room temperature.
Vigorously vortex the 4x QIAcuity OneStep Advanced Probe Master Mix and all individual solutions to ensure complete mixing. Centrifuge tubes briefly to collect all liquid at the bottom.
Prepare a master mix for a single 20 µl reaction according to the table below:
 
4x QIAcuity OneStep Advanced Probe Master Mix 5 µl
100x OneStep Advanced RT Mix 0.2 µl
WHO M gene forward primer (10 µM stock) 0.8 µl
WHO M gene reverse primer (10 µM stock) 0.8 µl
WHO M gene probe (10 µM stock) 0.4 µl
Enhancer GC (optional) 2.5 µl
RNase-Free Water To 18 µl (adjust for template volume)
Template RNA (added at step A5) 2 µl (or volume adjusted to input requirement)
Total reaction volume 20 µl
 
Mix all components of the master mix (excluding template) by gentle vortexing. Centrifuge briefly to collect liquid at the bottom of the tube.
Dispense 18 µl of the master mix (without template) into each well of a 96-well PCR plate on ice. Reactions may be assembled at room temperature owing to the hot-start RT enzyme; however, keeping on ice is recommended to minimise any non-specific activity.
Add 2 µl of template RNA (or RNase-Free Water for the NTC) to each well. Mix thoroughly by pipetting up and down at least 5 times.
Seal the plate with an optically clear adhesive seal. Centrifuge the plate at 500 × g for 1 minute to remove air bubbles and collect all liquid to the bottom of the wells.
 
B. RT-qPCR Run on the Bio-Rad CFX96
 
Switch on the Bio-Rad CFX96 instrument and open the CFX Manager software on the connected computer.
Create a new run protocol with the following cycling conditions:
 
Step Time Temperature
Reverse Transcription 40 min 50°C
RT Enzyme Inactivation / Initial Denaturation 2 min 95°C
3-step cycling — 40 cycles
    Denaturation 5 s 95°C
    Annealing 20 s 55°C*
    Extension / Fluorescence acquisition 30 s 60°C
Plate read End of each extension step 60°C
 
Note: *Annealing temperature may require optimisation depending on primer design and target. If fluorescence signal is low or non-specific amplification is observed, perform a gradient PCR (50–65°C) to determine the optimal annealing temperature.
Note: Select the fluorescence channel corresponding to the probe dye (HEX channel for the WHO M gene probe). Confirm channel selection in the CFX Manager plate editor before starting the run.
 
Set the plate type to "96-well" and assign the appropriate sample names, standards, and controls in the CFX Manager plate editor.
Place the sealed plate into the CFX96 instrument, ensuring it is correctly oriented and seated in the plate holder.
Start the run. The instrument will perform reverse transcription, initial denaturation, and then 40 cycles of amplification with fluorescence acquisition at the end of each extension step.
 
C. Data Analysis
 
Once the run is complete, open the results in the CFX Manager software.
Review the amplification curves for all wells. Confirm that positive controls show expected amplification and the no-template control (NTC) shows no amplification.
Set the fluorescence threshold using the automatic baseline-subtracted curve fit method, or adjust manually so that the threshold line intersects the exponential amplification phase across all wells. Record Cq (quantification cycle) values for each sample.
If absolute quantification is required, include a serial dilution standard curve of a known RNA standard in the same run. CFX Manager will calculate copy numbers automatically if the standard curve is defined.
For relative quantification, normalise Cq values to a validated reference gene using the 2−ΔΔCq method or equivalent.
Export results as a CSV or Excel file for further statistical analysis. For detailed guidance on data analysis using CFX Manager, refer to the Bio-Rad CFX Manager Software User Guide.
 
References:
 
1.    QIAGEN (2022). QIAcuity OneStep Advanced Probe Kit Quick-Start Protocol. HB-3048-003. www.qiagen.com
2.    Bio-Rad Laboratories (2023). CFX96 Touch Real-Time PCR Detection System Instruction Manual. www.bio-rad.com
3.    Bio-Rad Laboratories. CFX Manager Software User Guide. www.bio-rad.com
4.    World Health Organization (2023). Laboratory methods for the detection and characterisation of influenza virus. www.who.int.
Protocol for Influenza A Whole Genome Sequencing from RNA
 
Influenza A virus whole genome sequencing from RNA using the Native Barcoding Kit V14 (SQK-NBD114.24) — Single Reaction Protocol
 
Requirements:
 
Instruments/Laboratory ware:
Thermal cycler
Qubit fluorometer (or equivalent)
Magnetic separation rack (1.5 ml tubes)
Magnetic rack suitable for 96-well plates (e.g. DynaMag-96 Side Skirted Magnet, ThermoFisher, 12027)
Microfuge
Vortex mixer
Hula mixer (gentle rotator mixer)
Microplate centrifuge
P1000, P200, P100, P20, P10, P2 pipettes and tips
Ice bucket with ice
Timer
MinION Mk1D or GridION device
PCR hoods with UV steriliser (recommended)
 
Reagents:
 
Input material:
Extracted influenza A RNA in 10 mM Tris-HCl, pH 8.0 (minimum 1 µl per reaction)
 
Sequencing kit:
Native Barcoding Kit 24 V14 (SQK-NBD114.24; Oxford Nanopore Technologies)
SFB Expansion (EXP-SFB001) — additional Short Fragment Buffer required for the native barcode ligation step
R10.4.1 Flow Cell (FLO-MIN114)
Flow Cell Wash Kit (EXP-WSH004)
 
Consumables and reagents:
SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (ThermoFisher, cat. no. 12574018 or 12574026)
Nuclease-free water (ThermoFisher, cat. no. AM9937)
Agencourt AMPure XP beads (Beckman Coulter, cat. no. A63881)
Freshly prepared 80% ethanol in nuclease-free water
NEBNext Ultra II End Repair/dA-Tailing Module (NEB, cat. no. E7546)
NEB Blunt/TA Ligase Master Mix (NEB, cat. no. M0367)
NEBNext Quick Ligation Module (NEB, cat. no. E6056)
Eppendorf twin.tec PCR plate 96 LoBind, semi-skirted (Merck, cat. no. EP0030129504) with heat seals
1.5 ml Eppendorf DNA LoBind tubes
Qubit dsDNA HS Assay Kit (ThermoFisher, cat. no. Q32851) and Qubit Assay Tubes (Invitrogen, cat. no. Q32856)
Bovine Serum Albumin (BSA), 50 mg/ml (Invitrogen UltraPure BSA, cat. no. AM2616)
 
Influenza A primer sequences:
 
Tuni 12 ACGCGTGATCAGCAAAAGCAGG 100 µM
Tuni 12.4 ACGCGTGATCAGCGAAAGCAGG 100 µM
Tuni 13 ACGCGTGATCAGTAGAAACAAGG 100 µM
 
Methodology:
 
A. Reverse Transcription, PCR and Clean-Up
 
A1. Prepare the Influenza A primer mix
 
In a clean template-free pre-PCR hood, prepare the following primer mix in a 1.5 ml Eppendorf DNA LoBind tube:
 
Nuclease-free water 9.0 µl
Tuni 12 100 µM 0.4 µl
Tuni 12.4 100 µM 0.1 µl
Tuni 13 100 µM 0.5 µl
Total 10.0 µl
 
A2. Prepare the RT-PCR master mix (single reaction)
 
In the template-free pre-PCR hood, prepare the following master mix in a 1.5 ml Eppendorf DNA LoBind tube:
 
Nuclease-free water 23.3 µl
Influenza A primer mix (prepared above) 2.3 µl
2X Reaction Mix 29.2 µl
SuperScript‱ III RT/Platinum‱ Taq Mix 2.3 µl
Total (before sample addition) 57.1 µl
 
A3. Set up the RT-PCR reaction
Aliquot 57.1 µl of RT-PCR Master Mix into a single well of a 96-well PCR plate on ice.
Add 1 µl of nuclease-free water to a separate well as a negative control.
Seal the plate and transfer to a template-addition pre-PCR hood. Add 1 µl of influenza A RNA sample to the master mix well. Mix thoroughly by pipetting up and down.
Seal the plate, spin down briefly in a microplate centrifuge, and transfer to the thermal cycler.
 
A4. Thermal cycler programme (Influenza A; heated lid 105°C)
 
cDNA synthesis 42°C 60 min 1
Initial denaturation 94°C 2 min 1
Denaturation 94°C 30 sec 5
Annealing and extension 45°C / 68°C 30 sec / 3 min
Denaturation 94°C 30 sec 31
Annealing and extension 57°C / 68°C 30 sec / 3 min
Hold 4°C
 
A5. AMPure XP bead clean-up
Add 50 µl of resuspended AMPure XP beads to the PCR product. Mix by gentle pipetting and incubate at room temperature for 10 minutes.
Place the plate on the magnetic rack for 5 minutes until the eluate is clear and colourless. Pipette off and discard the supernatant.
Wash the beads with 200 µl of freshly prepared 80% ethanol without disturbing the pellet. Remove and discard the ethanol. Repeat the wash once.
Spin down and place back on the magnet. Remove any residual ethanol. Allow to air-dry for ~30 seconds — do not dry to the point of cracking.
Remove from the magnet. Resuspend the pellet in 15 µl of nuclease-free water. Incubate for 2 minutes at room temperature.
Pellet the beads on the magnet until the eluate is clear. Transfer 15 µl of eluate to a clean 1.5 ml Eppendorf DNA LoBind tube.
Quantify 1 µl of the eluate using a Qubit fluorometer.
Note: Samples may be stored at 4°C overnight or at −20°C for long-term storage.
 
B. End-Prep
Determine the volume of the cleaned-up PCR product that yields 200 fmol. Aliquot into a clean 1.5 ml tube.
Make the sample up to 12.5 µl with nuclease-free water.
Prepare the end-prep reaction in a 1.5 ml Eppendorf DNA LoBind tube by combining:
 
Sample in nuclease-free water 12.5 µl
Ultra II End-prep Reaction Buffer 1.75 µl
Ultra II End-prep Enzyme Mix 0.75 µl
Total 15 µl
 
Note: Do not vortex the Enzyme Mix. Thaw all reagents on ice and mix by pipetting.
Mix by pipetting. Seal and spin down briefly.
Incubate in the thermal cycler: 20°C for 5 minutes, then 65°C for 5 minutes.
Note: Proceed immediately to native barcode ligation. If pausing, clean up with 1X AMPure XP beads, elute in nuclease-free water, and store at 4°C.
 
C. Native Barcode Ligation
 
Important: Use one barcode per sample. Barcode wells are for single use only — do not reuse a well once opened.
 
1.
Thaw the NEB Blunt/TA Ligase Master Mix, EDTA, Native Barcodes (NB01–24), and Short Fragment Buffer (SFB) at room temperature. Spin down briefly and place on ice.
Assign a unique barcode to the sample.
Combine the following reagents per sample in a single well of a clean 96-well plate:
 
Reagent Volume per reaction
Nuclease-free water 6 µl
End-prepped DNA 1.5 µl
Native barcode (single barcode) 2.5 µl
Blunt/TA Ligation Master Mix 10 µl
Total 20 µl
 
Mix by pipetting. Seal and spin down. Incubate for 20 minutes at room temperature.
Add 4 µl of EDTA to stop the reaction. Mix thoroughly and spin down.
Transfer the barcoded sample to a clean 1.5 ml Eppendorf DNA LoBind tube (total volume ~24 µl).
Add AMPure XP beads for a 0.4X clean (approximately 10 µl beads to 24 µl sample). Mix by pipetting and incubate on a Hula mixer for 10 minutes at room temperature.
Pellet on a magnet for 5 minutes. Remove and discard supernatant. Wash twice with 700 µl Short Fragment Buffer (SFB), flicking to resuspend between washes. Then wash once with 100 µl freshly prepared 80% ethanol.
Allow to air-dry for ~30 seconds. Remove from the magnet and resuspend the pellet in 35 µl nuclease-free water by gently flicking.
Incubate at 37°C for 10 minutes, gently flicking every 2 minutes to encourage DNA elution.
Pellet beads on the magnet. Transfer 35 µl of eluate to a clean tube. Quantify 1 µl using a Qubit fluorometer.
 
D. Adapter Clean-Up
 
Important: The Native Adapter (NA) is not interchangeable with other sequencing adapters. Use Short Fragment Buffer (SFB), not ethanol, during the bead wash following adapter ligation.
 
Perform a flow cell check before starting to confirm sufficient active pores.
Thaw the NEBNext Quick Ligation Reaction Buffer (5X), Quick T4 DNA Ligase, Native Adapter (NA), Elution Buffer (EB), and Short Fragment Buffer (SFB) at room temperature. Spin down and place on ice. Do NOT vortex the Quick T4 DNA Ligase.
Combine the following in a 1.5 ml Eppendorf LoBind tube, pipette-mixing 10–20 times between each addition:
 
Reagent Volume
Pooled barcoded sample 30 µl
Native Adapter (NA) 5 µl
NEBNext Quick Ligation Reaction Buffer (5X) 10 µl
Quick T4 DNA Ligase 5 µl
Total 50 µl
 
Incubate for 20 minutes at room temperature.
Add 20 µl of resuspended AMPure XP beads. Mix by pipetting. Incubate on Hula mixer for 10 minutes at room temperature.
Pellet beads on a magnet for 5 minutes. Remove and discard supernatant. Wash twice with 125 µl Short Fragment Buffer (SFB), returning the tube to the magnet between washes.
Air-dry the pellet for ~30 seconds. Remove from the magnet and resuspend in 15 µl Elution Buffer (EB).
Incubate at 37°C for 10 minutes, flicking gently every 2 minutes. Pellet beads and transfer 15 µl eluate to a clean 1.5 ml tube.
Quantify 1 µl using a Qubit fluorometer. Prepare the final library to 12 µl in Elution Buffer (EB) at the appropriate molar concentration:
 
Fragment library length Flow cell loading amount
Very short (<1 kb) 100 fmol
Short (1–10 kb) 35–50 fmol
Long (>10 kb) 300 ng
 
Note: Store library at 4°C for short-term use or at −80°C for long-term storage (>3 months) in Eppendorf DNA LoBind tubes.
 
E. Priming and Loading the Flow Cell
 
Important: This kit is only compatible with R10.4.1 flow cells (FLO-MIN114). Allow the flow cell to equilibrate at room temperature for 20 minutes before priming.
 
Thaw Sequencing Buffer (SB), Library Beads (LIB), Flow Cell Tether (FCT), and Flow Cell Flush (FCF) at room temperature. Vortex to mix, spin down, and store on ice.
Prepare the priming mix by combining the following per flow cell:
 
Reagent Volume per flow cell
Flow Cell Flush (FCF) 1,170 µl
Bovine Serum Albumin (BSA, 50 mg/ml) 5 µl
Flow Cell Tether (FCT) 30 µl
Total 1,205 µl
 
Insert the flow cell into the device. Open the priming port and draw back 20–30 µl of buffer to remove any air bubble. Do not remove more than 30 µl.
Load 800 µl of priming mix via the priming port, avoiding air bubbles. Wait 5 minutes.
Mix Library Beads (LIB) by pipetting immediately before use. Combine the following in a clean 1.5 ml tube:
 
Reagent Volume per flow cell
Sequencing Buffer (SB) 37.5 µl
Library Beads (LIB) 25.5 µl
DNA library 12 µl
Total 75 µl
 
Open the SpotON sample port. Load an additional 200 µl of priming mix via the priming port.
Gently mix the prepared library by pipetting. Load 75 µl dropwise into the flow cell via the SpotON sample port — allow each drop to be absorbed before adding the next.
Gently replace the SpotON port cover. Close the priming port. Install the light shield immediately after loading.
Close the device lid and set up the sequencing run in MinKNOW using the settings in Section F below.
 
F. Data Acquisition and Basecalling
 
Important: Do not run sequencing and data analysis simultaneously on the same device.
 
Recommended MinKNOW settings:
 
Parameter Setting
Flow cell type FLO-MIN114
Kit SQK-NBD114.24
Basecalling On
Basecalling model High-accuracy (HAC)
Barcoding On
Barcode both ends On
Trim barcodes Off
Output formats .POD5 (On), .FASTQ (On), .BAM (On)
Minimum Q-score filter 9
Minimum read length 200 bp
 
G. Downstream Analysis
 
Analyse sequencing data using the CFIA-NCFAD/nf-flu pipeline
 
 
References:
 
1.    Zhou B et al. (2009). Single-reaction genomic amplification accelerates sequencing and vaccine production for classical and Swine origin human influenza A viruses. Journal of Virology.
2.    Oxford Nanopore Technologies (2025). Influenza virus sequencing from RNA using SQK-NBD114 (.24 or .96). Protocol version INF_9189_v114_revN.


Co-Admin of the Avian Flu folder:

Define the purpose of this folder:

Define the type of protocols that should be uploaded to this folder:

Define the naming convention that should be used for protocols in this folder:


Protocols will remain private until you are ready to publish them publicly. This will provide the protocol with a DOI and make it citable and searchable by the broader community.