Environmental DNA (eDNA) COI Metabarcoding PCR Protocol

Jacoby Baker; Kathleen Pitz

Sep 04, 2024

Environmental DNA (eDNA) COI Metabarcoding PCR Protocol

Forked from 18S V9 PCR

DOI

dx.doi.org/10.17504/protocols.io.4r3l2q1ejl1y/v1

Jacoby Baker¹,
Kathleen Pitz¹

¹MBARI

Better Biomolecular Ocean Practices (BeBOP)

Jacoby Baker

MBARI

DOI: dx.doi.org/10.17504/protocols.io.4r3l2q1ejl1y/v1

Protocol Citation: Jacoby Baker, Kathleen Pitz 2024. Environmental DNA (eDNA) COI Metabarcoding PCR Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.4r3l2q1ejl1y/v1

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Protocol status: Working

We use this protocol and it's working

Created: August 22, 2024

Last Modified: September 04, 2024

Protocol Integer ID: 106291

Funders Acknowledgements:

National Marine Sanctuaries as Sentinel Sites for a Demonstration Marine Biodiversity Observation Network (MBON)

Grant ID: NASA grant NNX14AP62A

Abstract

This protocol is aimed at amplifying the cytochrome c oxidase subunit I (COI) mitochondrial gene in eukaryotes. The primers (forward: mlCOIintF, reverse: HCO2198) utilized in this protocol are based on the primers utilized in Leray et al. 2013 (forward) and Folmer et al. 1994 (reverse).

Primers used: Fluidigm CS1+mlCOIinfF, Fluidigm CS2+HCO2198
Amplicons generated using this protocol can then be sequenced using the Illumina platform.

Primary PCR amplicon products are then sent to Michigan State University's (MSU) Research Technology Support Facility (RTSF) for indexing, pooling, and sequencing.

This work was supported by NASA grant NNX14AP62A ‘National Marine Sanctuaries as Sentinel Sites for a Demonstration Marine Biodiversity Observation Network (MBON)’ funded under the National Ocean Partnership Program (NOPP RFP NOAA-NOS-IOOS-2014-2003803 in partnership between NOAA, BOEM, and NASA), and the U.S. Integrated Ocean Observing System (IOOS) Program Office.

Minimum Information about an Omics Protocol (MIOP)

MIOP TermValue
methodology categoryomics analysis
projectMonterey Bay Time Series
purposetime series design [OBI:0500020]
analysesamplicon sequencing assay[OBI:0002767]
geographic locationMonterey Bay [GAZ:00002509]
broad-scale environmental contextmarine biome [ENVO:00000447]
local environmental contextupwelling [ENVO:01000005]
environmental mediumsea water [ENVO:00002149]
targetMitochondrial Cytochrome C Oxidase Subunit 1 [NCIT:C128943]
creatorJacoby Baker
materials requiredThermal Cycler [OBI:0400116]
skills requiredlaboratory technician with experience in PCR
time required
personnel required1
languageen
issued
audiencescientists
publisherMonterey Bay Aquarium Research Institute, Chavez Lab
hasVersion
license
maturity levelDemonstrated

Authors

PREPARED BY All authors known to have contributed to the preparation of this protocol, including those who filled in the template.AFFILIATIONORCID (visit https://orcid.org/ to register)DATE
Jacoby BakerMBARI0000-0002-0673-75352024-09-02
Kobun TrueloveMBARI0000-0002-2236-18492024-09-02
Kathleen Johnson PitzMBARI0000-0002-4931-85922024-09-02

PROTOCOL REVISION RECORD

Version numbers start at “1.0.0” when the protocol is first completed and will increase when changes that impact the outcome of the procedure are made (patches: 1.0.1; minor changes: 1.1.0; major changes: 2.0.0). Please store all versions in the gDrive folder designated to your institute.

VERSIONRELEASE DATE This is the date when a given protocol version was finalisedDESCRIPTION OF REVISIONS Please include a brief description of what was changed relative to the previous version
1.0.02022-04-25Initial release

RELATED EXTERNAL PROTOCOLS

This is a list of other protocols that are not in your folder which should be known to users of this protocol. These include, e.g., kit manuals. Please upload all relevant external protocols to Appendix A and link to them here.

EXTERNAL PROTOCOL NAME AND LINKISSUER / AUTHOR Please note who authored the protocol (this may also be a company name)ACCESS DATE This is the date you downloaded or scanned the protocol and uploaded it.
Environmental DNA (eDNA) COI metabarcoding Illumina MiSeq NGS PCR Protocol V2 https://mbari-bog.github.io/MBON-Protocols/eDNA_COI_PCR_V2.htmlCollin Closek, Anni Djurhuus, Katie Pitz, Ryan Kelly, Reiko Michisaki, Kristine Walz, Hilary Starks, Francisco Chavez, Alexandria Boehm, Mya Breitbartyyyy-mm-dd

ACRONYMS AND ABBREVIATIONS

ACRONYM / ABBREVIATIONDEFINITION
MBARIMonterey Bay Aquarium Research Institute
PCRpolymerase chain reaction
NTCno template control

GLOSSARY

SPECIALISED TERMDEFINITION
ampliconA piece of DNA or RNA that is the source and/or product of amplification or replication events (https://en.wikipedia.org/wiki/Amplicon)

BACKGROUND

This protocol is aimed at amplifying the cytochrome c oxidase subunit I (COI) mitochondrial gene in eukaryotes. 

This work was supported by NASA grant NNX14AP62A ‘National Marine Sanctuaries as Sentinel Sites for a Demonstration Marine Biodiversity Observation Network (MBON)’ funded under the National Ocean Partnership Program (NOPP RFP NOAA-NOS-IOOS-2014-2003803 in partnership between NOAA, BOEM, and NASA), and the U.S. Integrated Ocean Observing System (IOOS) Program Office.

Summary

This protocol is aimed at amplifying the cytochrome c oxidase subunit I (COI) mitochondrial gene in eukaryotes. The primers (forward: mlCOIintF, reverse: HCO2198) utilized in this protocol are based on the primers utilized in Leray et al. 2013 (forward) and Folmer et al. 1994 (reverse).

PCR reactions for COI were run with Fluidigm two-step amplification protocol for each sample

Method description and rationale

This method is applied because of its ability to amplify the target region (COI) across many different groups of organisms, the target region’s ability to discriminate between different taxa, and the common research application of this primer set allowing the data to be compared to a reference database and other published environmental datasets.

Spatial coverage and environment(s) of relevance

ocean [ENVO:00000015]
freshwater lake [ENVO:00000021]

PERSONNEL REQUIRED

1 technician

EQUIPMENT

DESCRIPTION e.g. filterPRODUCT NAME AND MODEL Provide the official name of the productMANUFACTURER Provide the name of the manufacturer of the product.QUANTITY Provide quantities necessary for one application of the standard operating procedure (e.g. number of filters).REMARK For example, some of the consumable may need to be sterilized, some commercial solution may need to be diluted or shielded from light during the operating procedure.
Durable equipment
ultraviolet light source [OBI:0002900]
PCR instrument [OBI:0000989]
electrophoresis system [OBI:0001053]
fluorometer [OBI:0400143]FMAX FluorometerMolecular Deviceswith SoftMaxPro v1.3.1
Consumable equipment
Agarose gel2
Agencourt AMPure XP bead systemBeckman Coulter, USA
Quant-It Picogreen dsDNA AssayLife Technologies
Chemicals
10% Bleach
70% Ethanol
RNase Away
Amplitaq Gold Fast PCR mastermix
molecular-biology grade water
forward and reverse primers (5 μM)

Preparation

Disinfect work surfaces with 10% bleach, followed by 70% ethanol.
RNase Away and pipets with RNase Away
UV pipets, molecular grade water, and tube racks for 20 minutes prior to starting protocol.

PCR

PCR reactions were run in single 75ul reactions for each sample using the 26bp primers (forward: mlCOIintF, reverse: HCO2198) utilized in this protocol are based on the primers utilized in Leray et al. 2013 (forward) and Folmer et al. 1994 (reverse) with Fluidigm adapters CS1 & CS2. All primers listed in the 5’ to 3’ direction.

PCR Primer NameDirectionSequence (5’ -> 3’)
Fluidigm CS1 and mlCOIinfFforwardACACTGACGACATGGTTCTACAGGWACWGGWTGAACWGTWTAYCCYCC
Fluidigm CS2 and  HCO2198 reverseTACGGAGCAGAGACTTGGTCTTAAACTTCAGGGTGACCAAAAAATCA

PCR reactions were run in 96-well plates with a NTC run in singleton for each plate

COI thermal cycling parameters (note: this is a touchdown PCR protocol)
These parameters use a normal ramp speed

PCR stepTemperatureDurationRepetition
denature95° C10 minutes1
16 Cycles of the folowing three steps
denature94° C10 seconds16
anneal62° C (this changes -1°C for each subsequent cycle)30 seconds16
extension68 °C60 seconds16
25 Cycles of the folowing three steps
denature94° C10 seconds25
anneal46° C30 seconds25
extension68 °C60 seconds25
extension72° C10 minutes1
hold4° Cinfinity1

Reaction Mixture: PCR reagents, volumes, initial and final concentrations
Total volume per reaction 75 μl

ReagentVolumeInitial ConcentrationFinal Concentration
Amplitaq Gold Fast PCR mastermix (Applied Biosystems)37.5 μl2X1X
Forward Primer (mlCOIintF)3 μl5 μM0.2 μM
Reverse Primer (HCO2198)3 μl5 μM0.2 μM
molecular-biology grade water28.5 μl
Template DNA3 μl1 - 20 ng/μl0.04 - 0.8 ng/μl

Quality control, PCR clean-up

After PCR amplification of the marker region, PCR products were run through an agarose gel to confirm the presence of target bands and absense of non-specific amplification across environmental samples as well as the absence of amplification in no-template controls (NTCs).

PCR products were purified and size selected using the Agencourt AMPure XP bead system (Beckman Coulter, USA).

A second agarose gel was run to confirm primer removal and retention of target amplicons after purification.

Purified products were then quantified using Quant-It Picogreen dsDNA Assay (Life Technologies) on an fmax Molecular Devices Fluorometer with SoftMaxPro v1.3.1

Next Steps

From here, the amplicon products will move onto the indexing PCR step, normalization, pooling, and sequencing.

REFERENCES

Leray M, Yang JY, Meyer CP, Mills SC, Agudelo N, Ranwez V, Boehm JT, Machida RJ. (2013) A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents. Frontiers in zoology, 10(1),1-4.
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3, 294–299.

APPENDIX A: DATASHEETS

	MIOP Term	Value
	methodology category	omics analysis
	project	Monterey Bay Time Series
	purpose	time series design [OBI:0500020]
	analyses	amplicon sequencing assay[OBI:0002767]
	geographic location	Monterey Bay [GAZ:00002509]
	broad-scale environmental context	marine biome [ENVO:00000447]
	local environmental context	upwelling [ENVO:01000005]
	environmental medium	sea water [ENVO:00002149]
	target	Mitochondrial Cytochrome C Oxidase Subunit 1 [NCIT:C128943]
	creator	Jacoby Baker
	materials required	Thermal Cycler [OBI:0400116]
	skills required	laboratory technician with experience in PCR
	time required
	personnel required	1
	language	en
	issued
	audience	scientists
	publisher	Monterey Bay Aquarium Research Institute, Chavez Lab
	hasVersion
	license
	maturity level	Demonstrated

PREPARED BY All authors known to have contributed to the preparation of this protocol, including those who filled in the template.	AFFILIATION	ORCID (visit https://orcid.org/ to register)	DATE
Jacoby Baker	MBARI	0000-0002-0673-7535	2024-09-02
Kobun Truelove	MBARI	0000-0002-2236-1849	2024-09-02
Kathleen Johnson Pitz	MBARI	0000-0002-4931-8592	2024-09-02

	VERSION	RELEASE DATE This is the date when a given protocol version was finalised	DESCRIPTION OF REVISIONS Please include a brief description of what was changed relative to the previous version
	1.0.0	2022-04-25	Initial release

	EXTERNAL PROTOCOL NAME AND LINK	ISSUER / AUTHOR Please note who authored the protocol (this may also be a company name)	ACCESS DATE This is the date you downloaded or scanned the protocol and uploaded it.
	Environmental DNA (eDNA) COI metabarcoding Illumina MiSeq NGS PCR Protocol V2 https://mbari-bog.github.io/MBON-Protocols/eDNA_COI_PCR_V2.html	Collin Closek, Anni Djurhuus, Katie Pitz, Ryan Kelly, Reiko Michisaki, Kristine Walz, Hilary Starks, Francisco Chavez, Alexandria Boehm, Mya Breitbart	yyyy-mm-dd

	ACRONYM / ABBREVIATION	DEFINITION
	MBARI	Monterey Bay Aquarium Research Institute
	PCR	polymerase chain reaction
	NTC	no template control

	SPECIALISED TERM	DEFINITION
	amplicon	A piece of DNA or RNA that is the source and/or product of amplification or replication events (https://en.wikipedia.org/wiki/Amplicon)

DESCRIPTION e.g. filter	PRODUCT NAME AND MODEL Provide the official name of the product	MANUFACTURER Provide the name of the manufacturer of the product.	QUANTITY Provide quantities necessary for one application of the standard operating procedure (e.g. number of filters).	REMARK For example, some of the consumable may need to be sterilized, some commercial solution may need to be diluted or shielded from light during the operating procedure.
Durable equipment
ultraviolet light source [OBI:0002900]
PCR instrument [OBI:0000989]
electrophoresis system [OBI:0001053]
fluorometer [OBI:0400143]	FMAX Fluorometer	Molecular Devices		with SoftMaxPro v1.3.1
Consumable equipment
Agarose gel			2
Agencourt AMPure XP bead system		Beckman Coulter, USA
Quant-It Picogreen dsDNA Assay		Life Technologies
Chemicals
10% Bleach
70% Ethanol
RNase Away
Amplitaq Gold Fast PCR mastermix
molecular-biology grade water
forward and reverse primers (5 μM)

PCR Primer Name	Direction	Sequence (5’ -> 3’)

Fluidigm CS1 and mlCOIinfF	forward	ACACTGACGACATGGTTCTACAGGWACWGGWTGAACWGTWTAYCCYCC
Fluidigm CS2 and HCO2198	reverse	TACGGAGCAGAGACTTGGTCTTAAACTTCAGGGTGACCAAAAAATCA

PCR step	Temperature	Duration	Repetition

denature	95° C	10 minutes	1
16 Cycles of the folowing three steps
denature	94° C	10 seconds	16
anneal	62° C (this changes -1°C for each subsequent cycle)	30 seconds	16
extension	68 °C	60 seconds	16
25 Cycles of the folowing three steps
denature	94° C	10 seconds	25
anneal	46° C	30 seconds	25
extension	68 °C	60 seconds	25
extension	72° C	10 minutes	1
hold	4° C	infinity	1

Reagent	Volume	Initial Concentration	Final Concentration
Amplitaq Gold Fast PCR mastermix (Applied Biosystems)	37.5 μl	2X	1X
Forward Primer (mlCOIintF)	3 μl	5 μM	0.2 μM
Reverse Primer (HCO2198)	3 μl	5 μM	0.2 μM
molecular-biology grade water	28.5 μl
Template DNA	3 μl	1 - 20 ng/μl	0.04 - 0.8 ng/μl

Public workspaceEnvironmental DNA (eDNA) COI Metabarcoding PCR Protocol

Environmental DNA (eDNA) COI Metabarcoding PCR Protocol