Dec 27, 2023

Environmental DNA (eDNA) 12S Metabarcoding PCR Protocol (with Platinum SuperFi II Taq) V.2

Version 1 is forked from PCR Protocol Template
  • 1MBARI
  • Better Biomolecular Ocean Practices (BeBOP)
Icon indicating open access to content
QR code linking to this content
Protocol CitationKathleen Pitz, Jacoby Baker 2023. Environmental DNA (eDNA) 12S Metabarcoding PCR Protocol (with Platinum SuperFi II Taq). protocols.io https://dx.doi.org/10.17504/protocols.io.e6nvwdm39lmk/v2Version created by Kathleen Pitz
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 27, 2023
Last Modified: February 06, 2024
Protocol  Integer ID: 92774
Keywords: [email protected], mifish primer pcr protocol, version of the mifish primer pcr protocol, metabarcoding environmental dna, metabarcoding pcr protocol, dna 12s rrna gene, mitochondrial dna, environmental dna, rrna gene in eukaryote, rrna gene, hypervariable region of the mitochondrial dna, pcr inhibitor, pcr, platinum superfi ii taq, dna, mifish, fish, platinum superfi ii, resistence to pcr inhibitor
Funders Acknowledgements:
David and Lucile Packard Foundation
NASA
Grant ID: 80NSSC21M0032
NOAA
Grant ID: NA22NOS0120184
Abstract
The 12S protocol is aimed at amplifying the hypervariable region of the mitochondrial DNA 12S rRNA gene in eukaryotes. The primers (MiFish-U-F & MiFish-U-R) used in this protocol were developed by Miya et al., 2015 for metabarcoding environmental DNA (eDNA) from fishes.

This protocol follows an updated version of the MiFish primer PCR protocol. The Platinum SuperFi II was designed to have high fideleity and have increased resistence to PCR inhibitors.
MIOP: Minimum Information about an Omics Protocol

MIOP TermValue
methodology categoryomics analysis
projectMarine Biodiversity Observation Network (MBON)
purposePCR [OBI:0000415]
analysesPCR [OBI:0000415]
geographic locationMonterey Bay [GAZ:00002509]
broad-scale environmental contextmarine biome ENVO_00000447
local environmental contextoceanic epipelagic zone biome [ENVO:01000033]
environmental mediumsea water [ENVO:00002149] | DNA extraction [OBI:0000257]
targetDNA extraction [OBI:0000257]
creatorJacoby Baker, https://orcid.org/0000-0002-0673-7535
materials requiredagarose gel electrophoresis system [OBI:0001134] | PCR instrument [OBI:0000989]
skills requiredsterile technique | pipetting skills
time required420
personnel required1
languageen
issued2023-11-14
audiencescientists
publisherMonterey Bay Aquarium Research Institute, Chavez Lab
hasVersionV.3
licenseCC BY 4.0
maturity levelMature
See https://github.com/BeBOP-OBON/miop/blob/main/model/schema/terms.yaml for list and definitions.

AUTHORS

PREPARED BY All authors known to have contributed to the preparation of this protocol, including those who filled in the template.AFFILIATIONORCID (visit https://orcid.org/ to register)DATE
Jacoby BakerMBARI0000-0002-0673-75352023-11-07
N. Kobun TrueloveMBARI0000-0002-2236-18492023-11-07
Kathleen J. PitzMBARI0000-0002-4931-85922023-11-07
Francisco ChavezMBARI2023-11-07
MBARI : Monterey Bay Aquarium Research Institute, Moss Landing, CA

RELATED PROTOCOLS

PROTOCOL NAME AND LINKISSUER / AUTHORRELEASE DATE This is the date corresponding to the version listed to the left
https://mbari-bog.github.io/MBON-Protocols/eDNA_12S_SupFi2_PCR_V3.htmlJacoby Baker2023-11-07
https://mbari-bog.github.io/MBON-Protocols/Bead_cleanup.htmlJacoby Baker2023-11-07
Environmental DNA (eDNA) 12S Metabarcoding Illumina MiSeq NGS Protocol with size selection V.2 ; dx.doi.org/10.17504/protocols.io.eq2lyj1kelx9/v2Jacoby Baker2023-12-27
This is a list of other protocols which should be known to users of this protocol. Please include the link to each related protocol.

ACRONYMS AND ABBREVIATIONS

ACRONYM / ABBREVIATIONDEFINITION
eDNAenvironmental DNA
NTCNo Template Control

GLOSSARY

SPECIALISED TERMDEFINITION
Content CellContent Cell
Content CellContent Cell

BACKGROUND
Summary
The 12S protocol is aimed at amplifying the hypervariable region of the mitochondrial DNA 12S rRNA gene in eukaryotes. The primers (MiFish-U-F & MiFish-U-R) used in this protocol were developed by Miya et al., 2015 for metabarcoding environmental DNA (eDNA) from fishes.

This work was supported by the David and Lucile Packard Foundation, and NASA award 80NSSC21M0032 and NOAA award NA22NOS0120184 in support of the CeNCOOS MBON.
Method description and rationale
This protocol follows an updated version of the MiFish primer PCR protocol. The Platinum SuperFi II was designed to have high fidelity and have increased resistance to PCR inhibitors.
Spatial coverage and environment(s) of relevance
This protocol has been used to amplify extracted DNA from filtered sea water samples taken from marine coastal stations off the western coast of North America (primarily off of California).

sea water [ENVO:00002149]
Personnel Required
1 technician.
Safety
Identify hazards associated with the procedure and specify protective equipment and safety training required to safely execute the procedure
Training requirements
Sterile technique, pipetting skills.
Time needed to execute the procedure
Total time is 7 hours.
PCR preparation and running the PCR protocol takes 3 hours. Running the following gel is 1 hour, bead cleanup setup preparation and process takes 2 hours, and then another gel is run for 1 hour.
EQUIPMENT

DESCRIPTION e.g. filterPRODUCT NAME AND MODEL Provide the official name of the productMANUFACTURER Provide the name of the manufacturer of the product.QUANTITY Provide quantities necessary for one application of the standard operating procedure (e.g. number of filters).REMARK For example, some of the consumable may need to be sterilized, some commercial solution may need to be diluted or shielded from light during the operating procedure.
Durable equipment
Agarose gel electrophoresis system
PCR Thermal Cycler
Consumable equipment
PCR platesSuperPlate PCR Plate, 96-well, semi-skirtedThermofisher Scientifichttps://www.thermofisher.com/order/catalog/product/AB2400#/AB2400
Plate sealsPCR Plate SealsBio Radhttps://www.bio-rad.com/en-us/product/pcr-plate-seals?ID=OC0OOTMNI
Chemicals
2X Platinum SuperFi II PCR Master Mix2X Platinum SuperFi II PCR Master MixThermofisher Scientifichttps://www.thermofisher.com/order/catalog/product/12368010

STANDARD OPERATING PROCEDURE
In the following SOP, please use the exact names of equipment as noted in the table above.

Provide a step-by-step description of the protocol. The identification of difficult steps in the protocol and the provision of recommendations for the execution of those steps are encouraged.
PREPARATION
BEFORE STARTING

Disinfect work surfaces with 10% bleach or RNase Away followed by a MilliQ / DI water rinse and 70% ethanol wipe. Clean pipet surfaces with RNase Away and ethanol wipe.
UV pipets, molecular grade water, and tube racks for 30 minutes prior to starting protocol.

PCR
1. eDNA template & PCR processing were performed at the Monterey Bay Aquarium Research Institute (MBARI). PCR reactions for the 12S locus were performed with a two-step amplification protocol for each sample using the MiFish_U primers (Miya et al. 2015) with Fluidigm adapters CS1 & CS2. All primers listed in the 5’ to 3’ direction. MiFish primers are in bold.

Fluidigm CS1+MiFish_U (forward):
ACACTGACGACATGGTTCTACA GTCGGTAAAACTCGTGCCAGC
Fluidigm CS2+Mifish_U (reverse):
TACGGTAGCAGAGACTTGGTCT CATAGTGGGGTATCTAATCCCAGTTTG

PCR Primer NameDirectionSequence (5’ -> 3’)
Fluidigm CS1 + 12S MiFish_UforwardACACTGACGACATGGTTCTACAGTCGGTAAAACTCGTGCCAGC
Fluidigm CS2 + 12S MiFish_UreverseTACGGTAGCAGAGACTTGGTCTCATAGTGGGGTATCTAATCCCAGTTTG

2. The primary PCR amplifications were carried out in singleton 50 μl reactions using:
  • 25 μL 2X Platinum SuperFi II PCR MM
  • 3 μL forward primer (10 μM)
  • 3 μL reverse primer (10 μM)
  • 3 μL eDNA extract template
  • 16 μL molecular-grade, nuclease-free water
3. PCR reactions were performed in 96-well plates with a no-template control (NTC) for each PCR plate, for a total of 3 PCR negative controls. An artificial community was used as a positive control.
4. Primary 12S cycling parameters, using the manufacturer’s recommendation with a slight modification. The Platinum SuperFi II is designed to be used with a universal 60°C annealing temperature, however, we found we had better results with an annealing temperature of 62°C to reduce bacterial co-amplification:

PCR stepTemperatureDurationRepetition
denaturation98°C30 seconds1
denaturation98°C10 seconds38 cycles
annealing62°C10 seconds38 cycles
extension72°C30 seconds38 cycles
final extension72°C5 minutes1
HOLD4°CHOLD1

Quality Control and Product Clean-up
1. After primary PCR amplification of the marker region the PCR product was run through a 2% agarose gel to confirm the presence of target bands (~270 bp) and absence of non-specific amplification (bacterial band ~370 bp) across environmental samples.

Primary PCR clean-up (Bead Clean-up Protocol)
2. Primary PCR products were purified and size selected using the Agencourt AMPure XP bead system (Beckman Coulter, USA) at 0.9x volume beads to product.
3. A second agarose gel was run to confirm primer removal and retention of target amplicons after purification. NTCs were also tested using a Qubit dsDNA 1x high sensitivity kit to ensure no amplification.

Secondary Amplification
The following steps are performed by MSU’s RTSF Genomics Core

1. Secondary amplification and NGS were performed at Michigan State University’s Research Technology Support Facility (RTSF). An aliquot of 20 μL from each purified primary PCR product was sent to RTSF Genomics Core at MSU for secondary PCR amplification with primers which targeted the CS1/CS2 ends of the primary PCR products and added dual indexed, Illumina compatible adapters with barcodes.

  • PE1-BC-CS1 (forward): 
AATGATACGGCGACCACCGAGATCT-[i5-BC(index 2)]-ACACTGACGACATGGTTCTACA
  • PE2-BC-CS2 (reverse): 
CAAGCAGAAGACGGCATACGAGAT-[i7-BC(index 1)]-TACGGTAGCAGAGACTTGGTCT

PCR Primer NameDirectionSequence (5’ -> 3’)
PE1-BC-CS1forwardAATGATACGGCGACCACCGAGATCT-[i5-BC(index 2)]-ACACTGACGACATGGTTCTACA
PE2-BC-CS2reverseCAAGCAGAAGACGGCATACGAGAT-[i7-BC(index 1)]-TACGGTAGCAGAGACTTGGTCT

2. The secondary PCR amplifications were carried out in 15 μL reactions, using 1 μL of primary PCR product.
  • 6 μl 2.5X HotMaster Mix
  • 7 μl DI water
  • 1 μl Primer Mix (6uM)
  • 1 μl primary eDNA PCR product
3. Secondary 12S cycling parameters:

PCR stepTemperatureDurationRepetition
denaturation95°C3 minutes1
denaturation95°C15 seconds15 cycles
annealing60°C30 seconds15 cycles
extension72°C1 minute15 cycles
final extension72°C3 minutes1
HOLD25°CHOLD1

QUALITY CONTROL
An agarose gel was run after secondary PCR to confirm the presence of target bands and absence of non-specific amplification across environmental samples as well as the absence of amplification in NTCs.

Products from the protocol are then used to create a pooled library and sequenced following a separate sequencing protocol (such as "Environmental DNA (eDNA) 12S Metabarcoding Illumina MiSeq NGS Protocol with size selection V.2", dx.doi.org/10.17504/protocols.io.eq2lyj1kelx9/v2 )
BASIC TROUBLESHOOTING GUIDE
Identify known issues associated with the procedure, if any. Provide troubleshooting guidelines when available.
REFERENCES
  1. Miya M et al. 2015 MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. R.Soc.opensci. 2: 150088. http://dx.doi.org/10.1098/rsos.150088
  2. Kawato, M., Yoshida, T., Miya, M., Tsuchida, S., Nagano, Y., Nomura, M., Yabuki, A., Fujiwara, Y. and Fujikura, K., 2021. Optimization of environmental DNA extraction and amplification methods for metabarcoding of deep-sea fish. MethodsX, 8, p.101238. https://doi.org/10.1016/j.mex.2021.101238
APPENDIX A: DATASHEETS
Link templates (e.g. preformatted spreadsheets) used to record measurements and report on the quality of the data as well as any documents such as manufacturer specifications, images, etc that support this protocol. Please include a short note describing the document’s relevance.