Protocol Citation: Marc Gastou, Ali Ghoochani, Natalia Gomez-Ospina, Monther Abu-Remaileh 2026. Endogenous N-terminal 3X FLAG Tagging of SLC45A1 in iPSCs (WTC11-Ngn2 Line). protocols.io https://dx.doi.org/10.17504/protocols.io.e6nvw1wzdlmk/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 11, 2024
Last Modified: January 11, 2026
Protocol Integer ID: 109686
Keywords: Endogenouse Flag tagging, iPSCs, CRISPR-Cas9, terminal 3x flag tagging of slc45a1, terminal of the slc45a1 gene, slc45a1 gene, slc45a1, stranded donor oligonucleotide, donor oligonucleotide, sgrna ribonucleoprotein, terminal 3x flag tagging, bp 3x flag tag, gene, point mutation, generating point mutation, 3x flag tag, cas9, directed repair, ipsc, start codon
Abstract
This protocol describes the steps for endogenously tagging the N-terminal of the SLC45A1 gene in WTC11-Ngn2 iPSCs with a 3X FLAG tag. It utilizes a Cas9-sgRNA ribonucleoprotein (RNP) complex and a single-stranded donor oligonucleotide (ssODN) template for homology-directed repair (HDR). The procedure can be adapted for generating point mutations or inserting sequences up to 130 bp. In this case, a 66 bp 3X FLAG tag is inserted after the start codon.
3X FLAG tag: GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAG (66 bp)
Right homology arm: 63 bp
Total: 200 bp
Guide sequence: CTGGCTGCGGGGATCATcg
Key Considerations:
Homology arms should be at least 35 bp long.
Ensure the guide RNA contains at least 2 mismatches within the first 7 bp following the PAM sequence in the template (leveraging genetic code redundancy) to prevent Cas9 from re-cleaving the template after HDR.
Pre-treatment of iPSCs (Day -1)
Objective: Enhance iPSC viability during nucleofection.
Plate iPSCs in regular growth medium at approximately 50% confluence.
Add 10 µM Thiazovivin to the medium.
Incubate cells overnight at 37 °C with 5% CO₂.
Preparation of Cas9-sgRNA RNP Complex (Day 0)
15m
Objective: Form the Cas9-sgRNA ribonucleoprotein (RNP) complex for delivery into iPSCs.
Mix 6 µg Cas9 enzyme with 3.2 µg sgRNA in a PCR tube.
Incubate at 37 °Cfor00:15:00 to form the RNP complex.
15m
Keep the RNP complex on ice until nucleofection.
Dissociation of iPSCs (Day 0)
8m
Objective: Prepare a single-cell suspension of iPSCs for nucleofection.
Aspirate the culture medium from iPSCs and add ReLeSR‱(Stemcell Technologies), incubate for 00:03:00to00:05:0037 °C
8m
Gently tap the plate to detach cells and resuspend cells in growth medium (StemFlex,Stemcell Technologies).
Count cells to ensure 0.3 x 10⁶ viable cells per nucleofection reaction.
Centrifuge at 1000 rpm ,00:03:00. Wash the cell pellet with sterile PBS and centrifuge again 1000 rpm, 00:03:00
6m
Resuspend the cell pellet with 20 µL P3 Nucleofector‱ Solution per nucleofection.
Nucleofection Setup (Day 0)
Objective: Introduce Cas9 RNP and ssODN template into iPSCs via nucleofection.
Add 6 µg ssODN to the 20 µL cell suspension (from step 5.5).
Gently transfer the cell suspension and ssODN (step 6.1) to RNP complex (from step 4.3).
Transfer the mixture to a well of the 16-well Nucleocuvette‱ Strip.
Insert the strip into the 4D-Nucleofector‱ system.
Run the program CA137 for iPSC nucleofection.
Immediately add 80 µL pre-warmed growth medium with 10 µM Thiazovivin to each nucleofected well.
Post-Nucleofection Culture (Day 0)
1d
Objective: Ensure survival and recovery of nucleofected iPSCs.
Plate nucleofected cells in a pre-coated 24-well plate (already coated with rhLaminin-521 or Matrigel) with pre-warmed growth medium.
Add 1 µM AZD7648 and 10 µM Thiazovivin to the medium.
Treatment with AZD7648, a DNA-PK inhibitor, aims to enhance HDR efficiency for improved integration.
Incubate cells at 37 °C, 5% CO₂ for 24:00:00
1d
Post-Transfection Treatment (Day 1)
3d
Objective: Facilitate cell recovery and discontinue AZD7648 treatment
After 24 hours, replace the culture medium with fresh iPSC growth medium.
Remove AZD7648, but continue treatment with 10 µM Thiazovivin.
Culture cells for an additional 72:00:00 to allow for recovery and expansion.
3d
Validation of 3X FLAG Tag Integration
Objective: Confirm successful integration of the 3X FLAG tag using PCR and Sanger sequencing.
Design PCR primers flanking the 3X FLAG insertion site, approximately 250–300 bp upstream and downstream of the insertion. Perform PCR for both edited and wildtype cells
Run the PCR products on a gel to confirm successful amplification. If the correct band is observed, send the PCR product for Sanger sequencing.
Analyze the sequencing data to confirm the presence of the 66 bp 3X FLAG sequence at the correct site, compared to wildtype cells, using SnapGene or similar tools
Optional: If integration is suboptimal, perform single-cell selection to isolate clones with the correct integration.