Feb 16, 2023
  • Linda A. Amaral-Zettler1,
  • Markus Bauer1,
  • Donna Berg-Lyons1,
  • Jason Betley1,
  • J. Greg Caporaso1,
  • Hugh W. Ducklow1,
  • Noah Fierer1,
  • Louise Fraser1,
  • Jack A. Gilbert1,
  • Niall Gormley1,
  • James Huntley1,
  • Susan M. Huse1,
  • Janet K. Jansson1,
  • Simon N. Jarman1,
  • Rob Knight1,
  • Chris L. Lauber1,
  • Elizabeth A. McCliment1,
  • Sarah M. Owens1,
  • Geoff Smith1,
  • Luke Thompson1,
  • Hege Vestheim1,
  • William A. Walters1
  • 1EMP Consortium
  • Earth Microbiome Project
Icon indicating open access to content
QR code linking to this content
Protocol CitationLinda A. Amaral-Zettler, Markus Bauer, Donna Berg-Lyons, Jason Betley, J. Greg Caporaso, Hugh W. Ducklow, Noah Fierer, Louise Fraser, Jack A. Gilbert, Niall Gormley, James Huntley, Susan M. Huse, Janet K. Jansson, Simon N. Jarman, Rob Knight, Chris L. Lauber, Elizabeth A. McCliment, Sarah M. Owens, Geoff Smith, Luke Thompson, Hege Vestheim, William A. Walters 2023. EMP 18S Illumina Amplicon Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.ewov1b6pgr24/v2Version created by Luke Thompson
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Index sequencing primer added to this version
Created: February 16, 2023
Last Modified: February 16, 2023
Protocol  Integer ID: 77107
Keywords: emp 18s illumina amplicon protocol, illumina amplicon protocol, sequencing primer, focus on microbial eukaryotic lineage, microbial eukaryotic lineage, amplification of vertebrate host dna, vertebrate host dna, libraries on the miseq, sequencing, blocking primer strategy, low eukaryotic biomass, illumina platform, primer strategy, blocking primer, different primer, eukaryote, outlines of the protocol, rrna, miseq, emp
Abstract
The 18S protocol detailed here is designed to amplify eukaryotes broadly with a focus on microbial eukaryotic lineages. The primers target the 18S SSU rRNA and are based on those of Amaral-Zettler et al. (2009). The constructs are designed to be used with the Illumina platform.
For running these libraries on the MiSeq and HiSeq, please make sure you read the supplementary methods of Caporaso et al. (2012). You will need to make your sample more complex by adding 5-10% PhiX to your run.
The outlines of the protocol are the same as the 16S protocol, but different primers, PCR conditions, and sequencing primers are used. In addition, we have designed a blocking primer that reduces the amplification of vertebrate host DNA to be used on host-associated samples, especially those that have a low eukaryotic biomass. Blocking primer strategy is based on Vestheim et al. (2008).
Guidelines
Ordering primers 
The primer sequences in this protocol are always listed in the 5′ -> 3′ orientation. This is the orientation that should be used for ordering. See the page Primer Ordering and Resuspension. Primer constructs were designed by Laura Wegener Parfrey.
Illumina_Euk_1391f forward primer: 
Field descriptions (space-delimited): 
  1. 5′ Illumina adapter
  2. Forward primer pad
  3. Forward primer linker
  4. Forward primer (1391f)

AATGATACGGCGACCACCGAGATCTACAC TATCGCCGTT CG GTACACACCGCCCGTC




Illumina_EukBr reverse primer, barcoded: 


  1. Reverse complement of 3′ Illumina adapter
  2. Golay barcode
  3. Reverse primer pad
  4. Reverse primer linker
  5. Reverse primer (EukBr)

CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXXXX AGTCAGTCAG CA TGATCCTTCTGCAGGTTCACCTAC

Mammal_block_I-short_1391f mammal blocking primer:
The mammal blocking primer is to be used when there is a high probability of picking up host genomic DNA. The C3 spacer (/3SpC3/) is a chemical modification that prevents extension during the PCR. Please note that the use of blocking primer reduces the number of host sequences detected but does not completely eliminate them. Thus remaining host sequences should also be filtered out during the analysis phase. We have found blocking primers to be particularly useful for host-associated samples with a low biomass of eukaryotic DNA. Note: Sequence is formatted for ordering from IDT.

GCCCGTCGCTACTACCGATTGG/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/TTAGTGAGGCCCT/3SpC3/

PCR reaction mixture 
No blocking primer


With blocking primer 


Notes:
  • PCR-grade water from Sigma (cat. no. W3500) or MoBio (cat. no. 17000-11)
  • Platinum Hot Start PCR Master Mix (2x) from ThermoFisher (cat. no. 13000014)
  • Final master mix concentration in 1x reaction: 0.8x
  • Final primer concentration in 1x reaction: 0.2 µM
  • Final blocking primer concentration in 1x reaction: 1.6 µM
Thermocycler conditions 
No blocking primer: 


With blocking primer: 


18S sequencing primers 
Euk_illumina_read1_seq_primer:
Field descriptions (space-delimited):
  1. Forward primer pad
  2. Forward primer linker
  3. Forward primer (1391f)

TATCGCCGTT CG GTACACACCGCCCGTC

Euk_illumina_read2_seq_primer:
Field descriptions (space-delimited):
  1. Reverse primer pad
  2. Reverse primer linker
  3. Reverse primer (EukBr)

AGTCAGTCAG CA TGATCCTTCTGCAGGTTCACCTAC


Euk_illumina_index_seq_primer:
Field description (space-delimited):
  1. Reverse complement of reverse primer (EukBr)
  2. Reverse complement of reverse primer linker
  3. Reverse complement of reverse primer pad

GTAGGTGAACCTGCAGAAGGATCA TG CTGACTGACT
References 
  • Amaral-Zettler, L. A., McCliment, E. A., Ducklow, H. W. & Huse, S. M. A method for studying protistan diversity using massively parallel sequencing of V9 hyper variable regions of small-subunit ribosomal RNA Genes. PLoS ONE 4, e6372 (2009).
  • Caporaso, J. G. et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J (2012). doi:10.1038/ismej.2012.8
  • Vestheim, H. & Jarman, S. N. Blocking primers to enhance PCR amplification of rare sequences in mixed samples – a case study on prey DNA in Antarctic krill stomachs. Frontiers in Zoology 2008 5:1 5, 12 (2008).
Materials
MATERIALS
Please see Guidelines section for required materials.
STEP MATERIALS
Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher/Invitrogen cat. no. P11496Invitrogen - Thermo FisherCatalog #P11496
UltraClean PCR Clean-Up KitMobioCatalog #12500
Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher/Invitrogen cat. no. P11496Invitrogen - Thermo FisherCatalog #P11496
UltraClean PCR Clean-Up KitMobioCatalog #12500
Protocol materials
Please see Guidelines section for required materials.
Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher/Invitrogen cat. no. P11496Invitrogen - Thermo FisherCatalog #P11496
UltraClean PCR Clean-Up KitMobioCatalog #12500
Safety warnings
Please refer to the SDS (Safety Data Sheet) for hazard information.
Amplify samples in triplicate, meaning each sample will be amplified in 3 replicate 25-µL PCR reactions.
Pool triplicate PCR reactions for each sample into a single volume (75 µL). 
Note
Do not combine amplicons from different samples at this point.
Run amplicons from each sample on an agarose gel. 
Note
Expected band size for 1391f-Eukbr is ~260 bp. Low-biomass samples may yield faint or no visible bands; alternative methods such as a Bioanalyzer could be used to verify presence of PCR product.
Quantify amplicons with Quant-iT PicoGreen dsDNA Assay Kit (follow manufacturer’s instructions).
Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher/Invitrogen cat. no. P11496Invitrogen - Thermo FisherCatalog #P11496
Protocol
CREATED BY
Bonnie Poulos
Warm Quant-iT PicoGreen reagent to room temp in the dark.
Note
PicoGreen reagent is diluted in dimethylsulfoxide (DMSO) which solidifies at refrigerator temperatures. It must be completely liquified before use by allowing it to come to room temperature. Vortex solution briefly to mix well and centrifuge for 5 sec to bring liquid to bottom of tube; then dispense for use in the assay. PicoGreen reagent is also light-sensitive, so reagent should be protected from light.
Quant-iT PicoGreen dsDNA kitThermo ScientificCatalog #P7589
Prepare 1XTE buffer from 20X stock solution using nuclease-free water:  will need 200 μl/well (for diluting standards, samples and PicoGreen).
Note
Prepare 1X TE by pipetting 2.5 mL of 20X stock TE into a sterile 50 mL centrifuge tube and filling to 50 mL mark with molecular biology grade water. Invert tube to mix.
Dilute DNA standard to either “High” 2 μg/mL (1:50 of λ DNA stock) or “Low” 50 ng/mL (1:1000 of λ DNA stock).
Note
It is best to run standards in duplicate, and if amount of DNA in samples is unknown or varys widely, it is also best to run both the high and low DNA standards.
Determine amount of sample to assay (eg, 2μl sample in total of 100μl TE buffer). Add correct amount of TE buffer to all wells. Add standards to wells. Then add samples to wells.
Note
See Guidelines for amount of DNA standards to add to standard wells.
Dilute PicoGreen 1:200 in TE buffer and protect from light until ready to add to plate.
Note
A 1:200 dilution of PicoGreen reagent is prepared by adding 10 μl of PicoGreen per 2 mL of 1X TE buffer. You will need 100 ul diluted PicoGreen per well containing 100 ul sample.
Add equivalent volume (100 μl) of diluted PicoGreen to every well (keeping plate in the dark as much as possible).
Tap plate to mix.
Incubate 5 minutes at room temperature keeping plate in the dark.
00:05:00
Take fluorescent readings using 485nm excitation and 535nm emission filters.
Determine standard curve and calculate concentration of DNA in samples (see table in the guidelines).
Combine an equal amount of amplicon from each sample (240 ng) into a single, sterile tube. Higher amounts can be used if the final pool will be gel-isolated or when working with low-biomass samples. 
Note
When working with multiple plates of samples, it is typical to produce a single tube of amplicons for each plate of samples.
Clean amplicon pool using MoBio UltraClean PCR Clean-Up Kit (follow manufacturer’s instructions). 
Note
If working with more than 96 samples, the pool may need to be split evenly for cleaning and then recombined.
Optional: If spurious bands were present on gel (in step 3), one-half of the final pool can be run on a gel and then gel extracted to select only the target bands.
UltraClean PCR Clean-Up KitMobioCatalog #12500
Measure concentration and A260/A280 ratio of final pool that has been cleaned. 
Note
For best results the A260/A280 ratio should be between 1.8-2.0.
Send an aliquot for sequencing along with sequencing primers listed in Guidelines