Sep 25, 2023
  • 1Australian National University
Icon indicating open access to content
QR code linking to this content
Protocol Citation: Alicia Grealy 2023. DSBEST v2.0 (Caroe et al. 2018). protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlkemwxl5r/v1
Manuscript citation:
Caroe C, Gopalakrishnan S, Vinner L, Mak SST, Sinding MHS, Samaniego JA, Wales N, Sicheritz-Ponten T, Gilbert MTP. 2018. Single-tube library preparation for degraded DNA. Methods in Ecology and Evolution, 9: 410-419.
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 11, 2020
Last Modified: September 25, 2023
Protocol  Integer ID: 34125
Keywords: bench protocol, shotgun library, stranded dna, preparing shotgun library, dna, degraded dna, protocol
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
This bench protocol is based on the work of Caroe et al. (2018), for preparing shotgun libraries from double-stranded DNA, typically for ancient and degraded DNA. Please cite Caroe et al. (2018) if you use this bench protocol!
Guidelines
Use at your own risk. You are responsible for double-checking that everything is correct!

Familiarise yourself with the relevent literature (Caroe et al. 2018) before attempting!
Materials
MATERIALS
Bst 2.0 WarmStart DNA Polymerase - 1,600 unitsNew England BiolabsCatalog #M0538S
T4 DNA Polymerase - 150 unitsNew England BiolabsCatalog #M0203S
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
MinElute PCR Purification KitQiagenCatalog #28004
Tris-HCl, pH 8.0 (UltraPure)Thermo Fisher ScientificCatalog #15568025
5 M Sodium chloride (NaCl)Merck MilliporeSigma (Sigma-Aldrich)Catalog #S5150-1L
DMSO Merck MilliporeSigma (Sigma-Aldrich)Catalog #D8418
T4 Polynucleotide KinaseNew England BiolabsCatalog #M0201S
UltraPure™ DNase/RNase-Free Distilled WaterThermo FisherCatalog #10977049
AmpliTaq Gold™ DNA Polymerase with Gold Buffer and MgCl2Thermo FisherCatalog #4311806
SYBR™ Green I Nucleic Acid Gel Stain - 10,000X concentrate in DMSOThermo FisherCatalog #S7563
Sera-Mag Speed BeadsGE HealthcareCatalog #65152105050250
UltraPure 0.5M EDTA pH 8.0Invitrogen - Thermo FisherCatalog #15575020
Tween 20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P2287-100ml
Bovine Serum Albumin (BSA)Catalog #BSA-50
dNTPs 100 mM ea.BiolineCatalog #BIO-39025
T4 DNA ligase reaction bufferNew England BiolabsCatalog #Supplied with M0202S
Isothermal amplification bufferNew England BiolabsCatalog #Supplied with M0538S
PEG-4000 50% w/vNew England BiolabsCatalog #Supplied with M0202S


OligosConcentrationWorking concentrationSynthesis scalePurificationSupplierResuspension bufferSequence 5'-3'
IS1500 uMna100 nmolHPLCIDT10 mM Tris-HClA*C*A*C*TCTTTCCCTACACGACGCTCTTCCG*A*T*C*T
IS2500 uMna100 nmolHPLCIDTTEG*T*G*A*CTGGAGTTCAGACGTGTGCTCTTCCG*A*T*C*T
IS3500 uMna100 nmolHPLCIDTTEA*G*A*T*CGGAA*G*A*G*C/3SpC3/
CL104_duplex (order as double-stranded DNA)100 uM0.1 uM100 nmolHPLCIDTTET buffer/5Phos/TCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGA/3Phos/
CL107100 uM10 uM25 nmoldesaltedIDTWaterTCATGTAACTCGCCTTGATCGT
CL108100 uM10 uM25 nmoldesaltedIDTWaterTCGTCGTTTGGTATGGCTTC
IS7100 uM10 uM25 nmoldesaltedIDTWaterACACTCTTTCCCTACACGAC
IS8100 uM10 uM25 nmoldesaltedIDTWaterGTGACTGGAGTTCAGACGTGT
CL72_Custom_Seq_Primer100 uMna25 nmoldesaltedIDTWaterACACTCTTTCCCTACACGACGCTCTTCC
CL72_i5_index100 uMna25 nmoldesaltedIDTWaterGGA AGA GCG TCG TGT AGG GAA AGA GTG T
CL105_CL106_Std100 uMDilute to 10^11 - 10^2 copies/ul4 nmol UltramerdesaltedIDTTET bufferACACTCTTTCCCTACACGACGCTCTTCCTCGTCGTTTGGTATGGCTTCTATCGUATCGATCGATCGACGATCAAGGCGAGTTACATGAAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
P5-indexing primer100 uM10 uM25 nmoldesaltedIDTWaterAATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTT
P7-indexing primer100 uM10 uM25 nmoldesaltedIDTWaterCAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGT
Table 1. Oligos needed. Store all oligos at -20 deg C.


Equipment needed

Thermalcycler
Bench-top centrifuge
QuantStudio 3 qPCR machine
P1000, P200, P100, P20, P10, P2 pipettes and extra-long filter tips
10% Household bleach solution
70% Ethanol
Kimwipes and paper towels
15 ml Falcon tubes
1.5 ml Safelock tubes
1.5 ml Lo-bind Safelock tubes
0.5 ml Lo-bind Safelock tubes
0.2 ml Lo-bind PCR tubes
8-well strip optical qPCR tubes with attached lid (0.1 ml profile)
Sharps container
UV glove box
96-well PCR plate rack
1.5 ml-2.0ml tube racks
15 ml tube racks
50 ml tube racks
Minispin
Vortex

Before start
I have begun including a double-stranded positive control oligo (dsCL104) in the library preparation; this is a double-stranded form of the single-stranded oligo described in Gansauge and Meyer (2013). Always include no-template controls and any extraction controls.

Store PEG and ATP at -20 deg C and avoid repeated rounds of freeze thawing.

Store MyOne C1 Streptavidin beads at 4 deg C in a fridge.
Preparation
30m

Note
Perform all reaction set-up steps in a reagent-only pre-PCR space inside a dedicated ultraclean environment. Add DNA and subsequent master-mixes to the reaction, and perform wash steps, in a separate pre-PCR space.

"Suit up" in this order: hair net, nitrile gloves, facemask, coveralls, gumboots, booties, second pair of gloves.
Prepare the space by decontaminating surfaces with 10% household bleach followed by 70% ethanol. UV irradiate pipettes and racks. Racks should be bleached between subsequent uses and UV irradiated.
Ensure ice is available. Thaw reagents on ice as needed. Keep enzymes on ice at all times. Do not vortex enzymes to mix but mix by flicking the tube gently. Pulse centrifuge all reagents before opening.
Label tubes.

ABC
TubeQtyFor ...
1.5 ml Safelock Tube105X SYBR
0.5 ml Safelock Tube825 mM dNTPs
1.5 ml Safelock Tube10.1 uM CL104_duplex
1.5 ml Safelock Tube10.1 uM CL105_duplex 1/500
1.5 ml Safelock Tube110 uM IS7
1.5 ml Safelock Tube110 uM IS8
1.5 ml Safelock Tube110 uM CL107
1.5 ml Safelock Tube110 uM CL108
1.5 ml Safelock Tube10CL105_106 STD dilution series 10^11 - 10^2
15 ml Falcon Tube1TE Buffer
15 ml Falcon Tube1TET buffer
1.5 ml Safelock Tube1Oligo hybridisation buffer
1.5 ml Safelock Tube1Reaction enhancer
15 ml Falcon Tube1EBT buffer
0.2 ml Lo-bind PCR tube2Adapters (P5_DS1, P7_DS2)
0.5 ml Lo-bind PCR tube1Adapters mix (DS_adapter_mix)
0.5 ml Lo-bind PCR tube1Adapters mix dilution
0.2 ml Lo-bind PCR Tube# of samples + 2Reaction tubes
1.5 ml Lo-bind Tube3Step 19, Step 24, Step 27 master mixes
1.5 ml Lo-bind Tube# of samples + 2Combining library with PB buffer
1.5 ml Lo-bind Tube# of samples + 2Elution of library from spin column
QIAGEN MinElute PCR Purification Spin Columns# of samples + 2Purification of library
0.5 ml Lo-bind Tube# of samples + 2Final library
0.5 ml Lo-bind Tube# of samples + 21/20 dilution of library
1.5 ml Safelock Tube2Assay A and B master mixes
8-strip optical qPCR Tubes(((# of samples + 2)*2)+26)/8Assay A and B

Prepare all necessary buffers and UV decontaminate where appropriate.
Note
Aliquot 5X SYBR into 500-ul batches and store at -20 deg C in foil.

Aliquot dNTPs into 50-ul batches and store at -20 deg C.

ABCD
BufferReagentVolume to addFinal concentration in solution
Oligo hybridisation buffer 10X5 M NaCl100 ul500 mM
1 M Tris-HCl10 ul10 mM
0.5 M EDTA2 ul1 mM
Ultrapure water888 ulna
Reaction enhancer50% PEG-4000500 ul25%
10 mg/ml BSA200 ul2 mg/ml
5 M NaCl80 ul400 mM
Ultrapure water220 ulna
TE BufferUltrapure water9.88 mlna
(Exp. 1 year)1 M Tris-HCl100 ul0.01 M
0.5 M EDTA20 ul0.001 M
EBT1 M Tris-HCl100 ul0.01 M
100% Tween 205 ul0.05%
Ultrapure water9.895 mlna
TET buffer1 M Tris-HCl500 ul0.01 M
(Exp. 1 year)0.5 M EDTA100 ul0.001 M
100% Tween 2025 ul0.05%
Ultrapure water49.375 mlna
5X SYBR10,000X SYBR2.5 ul5X
DMSO997.5 ulna
DMSO4 mlna
25 mM dNTPs100 mM dATP100 ul25 mM
100 mM dTTP100 ul25 mM
100 mM dCTP100 ul25 mM
100 mM dGTP100 ul25 mM

Before resuspending oligos, pulse centrifuge to collect the pellet at the bottom of the tube. Add the appropriate buffer (see Materials) and vortex thoroughly. Store at -20 deg C. Dilute out the working concentrations (below) and store at -20 deg C when not in use. Thaw on ice. Vortex and pulse centrifuge after each thaw. Before beginning library preparation, make sure you have enough of each working stock prepared!

Note
Note: Do not store oligos and adapters in the same box as enzymes or reagents!

The standards should be diluted in a totally different space, such as a teaching lab to ensure it does not contaminate the lab at extremetly high concentration.

Also take extreme care with the positive control oligo as it will become a template for library preparation!

ABC
Working stockReagentVolume to add
10 uM CL104_duplex100 uM CL10450 ul
TET buffer450 ul
0.1 uM CL104_duplex10 uM CL1045 ul
TET buffer495 ul
0.1 uM CL104_duplex 1/5000.1 uM CL1041 ul
(i.e., 0.0002 uM)TET buffer499 ul
10 uM IS7100 uM IS750 ul
Ultrapure water450 ul
10 uM IS8100 uM IS850 ul
Ultrapure water450 ul
10 uM CL107100 uM CL10750 ul
Ultrapure water450 ul
10 uM CL108100 uM CL10850 ul
Ultrapure water450 ul
10 uM CL105_106_STD100 uM CL105_106_STD50 ul
TET buffer450 ul
10^11 copies CL105_106_STD10 uM CL105_106_STD10 ul
TET buffer592.25 ul
10^10 copies CL105_106_STD10^11 copies CL105_106_STD50 ul
TET buffer450 ul
10^9 copies CL105_106_STD10^10 copies CL105_106_STD50 ul
TET buffer450 ul
10^8 copies CL105_106_STD10^9 copies CL105_106_STD50 ul
TET buffer450 ul
10^7copies CL105_106_STD10^8 copies CL105_106_STD50 ul
TET buffer450 ul
10^6 copies CL105_106_STD10^7copies CL105_106_STD50 ul
TET buffer450 ul
10^5 copies CL105_106_STD10^6 copies CL105_106_STD50 ul
TET buffer450 ul
10^4 copies CL105_106_STD10^5 copies CL105_106_STD50 ul
TET buffer450 ul
10^3 copies CL105_106_STD10^4 copies CL105_106_STD50 ul
TET buffer450 ul
10^2 copies CL105_106_STD10^3 copies CL105_106_STD50 ul
TET buffer450 ul

Pre-program the thermal cycler.
Prepare adapters
40m
In a 0.2 ml Lo-bind PCR tube ("P5_DS1"), combine:
40 ul of 500 uM IS1
40 ul of 500 uM IS3
10 ul Ultrapure water
10 ul 10X Oligo Hybridisation Buffer

Vortex and pulse centrifuge.
In a new 0.2 ml Lo-bind PCR tube ("P7_DS2"), combine:
40 ul of 500 uM IS2
40 ul of 500 uM IS3
10 ul Ultrapure water
10 ul 10X Oligo Hybridisation Buffer

Vortex and pulse centrifuge.
Incubate both "P5_DS1" and "P7_DS2" in a thermal cycler:
95 deg C for 10 sec
Ramp down to 12 deg C at a rate of 0.1 deg C/sec

Combine both "P5_DS1" and "P7_DS2" together in a 0.5 ml Lo-bind Safelock tube to give 200 ul of 100 uM "DS_adapter_mix".
Determine the DNA input amount and concentration of adapters required
30m
Measure the concentration of your DNA extract on the Qubit following the manufacturer's instructions.



If possible, run the DNA on a fragment analyser or gel electrophoresis to determine the fragment length distribution.

Protocol
2% Agarose Gel Electrophoresis
CREATED BY
Alicia Grealy







Note
For ancient DNA it is seldom possible to quantitate the DNA or examine fragment lengths. For these, assume the average fragment length is 40 bp.

Make up 2 L of 1X TAE buffer:
50 ml of 40X TAE buffer
1950 ml of MilliQ water

Mix by inversion.
Using an electronic balance, weigh out 2.2 g of agarose powder on to a weigh boat using a spatula.
Note
Note that gel concentration can be adjusted. The more concentrated the gel, the greater the resolution of small fragment sizes.

Transfer the powder to a 200 ml conical flask.
Using the graduated measurng cylinder, measure out 110 ml of 1xTAE buffer. Add to the conical flask containing the agarose powder. Swirl the flask gently to mix.
Microwave the flask uncovered for 1 minute.

Safety information
A lid can loosly be placed over the flask but DO NOT tighten--allow steam to escape. Do not microwave for more than 1 minute at a time.

Do not fill flasks or beakers/Schott bottles more than half full with liquid!

Remove the flask from the microwave using oven mitts and swirl gently.
Safety information
The liquid is boiling! Use oven mitts to handle flask. Do not put your face over the opening to the flask as liquid can splash out!

Microwave the flask for a further minute but remove from the microwave if the agarose appears to boil excessively. Swirl to mix and examine near a light source to ensure the agarose has melted. Allow to cool for 5 minutes.
Place the gel casting tray into a rubber vice that will seal the ends tightly, or tape the ends with masking tape.
Place the assembly on a flat bench and use the spirit level to check it is level--adjust if needed.
Place a 20-well comb into the casting tray.
When the flask is cool to the touch, add 5 ul of SYBR Safe and swirl gently to mix. Avoid generating bubbles.
Safety information
Wait until the liquid is warm (not boiling) to cast the gel, or the tray may crack!

Pour the liquid gel slowly into the casting tray. Pop any bubbles that have formed using a clean pipette tip.
Let the gel set for 20-30 minutes at room temperature.
Allow residual gel to set in the flask, then scrape into the bin. Fill the flask half full with water and microwave until the water boils. Pour the water down the sink and clean the flask using a bottle brush.
When the gel is set, remove the combs gently.
Place the casting try and gel in the electrophoresis tank.
Fill the electrophoresis tank with 1 X TAE buffer to the fill line indicated on the tank.
Pipette 3 ul of 50 bp DNA ladder into the first well of the gel.

Note
The recommended volume will depend on the concentration of the ladder. Check the manufacterer's recommendations. If the ladder is not pre-mixed with loading dye, be sure to add 1-2 ul of loading dye before loading into the gel.

Place some Parafilm across a 96-well PCR plate rack and press down firmly to create small wells.
For each sample, pipette 1-2 ul of loading dye onto the Parafilm, taking care not to pierce the Parafilm.
Mix 10 ul of PCR product with the loading dye by pipetting gently up and down.

Transfer the 12 ul of PCR product/loading dye to the wells of the gel, taking care not to pierce the bottom of the well with the pipette tip.
Note
The volume each well can take will depend on the size of the comb used. Be sure not to overload the wells or product will float out the top of the well.

Place the lid on the gel tank and plug the electrodes into the appropriate power slots. Ensure the positive electrode is at the base of the gel.



Safety information
Take care when working with electricity and water!

Check electrical cords of all equipment and ensure none are damaged and that cords are not a tripping hazard. Do not use if the electrical cord is damaged in any way. Tag the instrument with warnings, make the area safe, and notify your line manager and anyone else in the immediate area that may be affected.

Use electrical equipment indoors only in an area free of explosive material, corrosive gas, powerful vibrations, direct exposure to sunlight, and temperature fluctuations. Use in a space where cables will not come into contact with liquids, be manually damaged, or interfere with other workplace operations.

Do not use electrical equipment with any other power adapter or cord than the one supplied.

Switch the power pack on a set the voltage to 80 V and the time to 1 hr and 10 min.
Note
Note that the voltage and time can be adjusted to suit what you are running on the gel. For amplicons (one small product), I will run the gel at 96 V for 30-40 min. For shotgun libraries, I will run the gel as above. The lower the voltage and longer it is run, the greater the separation of fragments will be.

Press 'Run' or 'Start' on the power pack and check to see that bubbles are rising from electrodes.
When the run is over, switch of the power pack, remove the lid, and remove the gel from the tank, taking care not to let it slide off the tray.
Safety information
Do not remove the lid to the electrophoresis tank until the power pack is switched off.

Place the gel on the UV transilluminator and photograph using the attached camera. Follow the manufactuerer's instructions to use the equipment.


Safety information
Take care working with UV. You should have UV safety training. Do not open the transilluminator while the UV is on! Use signage to warn others when the UV is on.

Discard the gel into a designated biohazard bin, and clean the UV dock with 70% ethanol.
Dispose of used tips into a designated sharps container.
Dispose of gel waste into a biohazard bag.
Used combs, beakers, flasks, and tray should be washed with warm water and placed on a rack to dry.
Gloves and chemical waste should be sealed in a biohazard bag for incineration.
Calculate the molarity of the dsDNA ends. Use the calculator at:

Expected result
e.g., 1 ul of 0.1 uM CL104_duplex

Mass dsDNA input (ng) = 3.71 ng
Length (bp) = 60 bp
pmol dsDNA ends = 2*(((ng-input/1000/1000)/((length*617.96)+36.04))*1000*1000*1000)
= 0.2 pmol
Input ds copy number = ((pmol dsDNA ends/2)/1000/1000/1000/1000)*(6.022E+23)
= 6.02E+10

Calculate the pmol of adapters needed. This is approximately 10X the molarity of the dsDNA ends. Round up to the nearest 10 pmol.

This number is equal to the concentration of adapters needed in uM.

Dilute the adapters to the desired working concentration in EBT buffer.

Expected result
e.g., for the CL104_duplex above, 0.2 x 10 pmol adapter is needed, i.e., 2 pmol. Rounding up to the nearest 10 pmol gives 10 pmol.

The concentration of adapters needed 10 uM.

Note
The final concentration of the adapters in the ligation reaction (below) should be 0.2 uM.

Usually do not put in fewer than 10 pmol adapter, even for very low template samples.


End Repair
1h 10m
Combine the following in a 1.5 ml Lo-bind Safelock tube. Vortex and pulse centrifuge.


ABCDEF
ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)x _______ rxn
T4 DNA ligase buffer w/ 10 mM ATP (NEB)40 ul10 X1 X4 ul
T4 DNA Polymerase40 ul3 U/ul0.03 U/ul0.4 ul
T4 PNK40 ul10 U/ul0.25 U/ul1 ul
Reaction enhancer40 ulnana2.2 ul
dNTPs40 ul25 mM0.25 mM0.4 ul

Aliquot 8 ul into a 0.2 ml Lo-bind PCR tube for each reaction.
To make the total reaction volume up to 40 ul, add:

Up to 32 ul DNA to each sample reaction. Make up the remainder with Ultrapure water. Typically input 3x10^8 - 3x10^11 double-stranded molecules; 13 pg-14 ng of ca. 40 bp DNA--this is typically 20% of the extract.

1 ul of 0.1 uM CL104_duplex positive control oligo to the positive conrol reaction + 31 ul Ultrapure water. We are inputing 3.01x10^10 molecules of single-stranded CL104 into the library preparation.

32 ul of Ultrapure water to the no-template control reaction.

Vortex and pulse centrifuge.
Incubate in a thermal cycler at:
20 deg C for 30 min
65 deg C for 30 min
4 deg C hold
Adapter ligation
50m
Add 1 ul of the DS_adapter_mix DILUTION (e.g., 10 uM) to the finished end-repair reaction above. Vortex and pulse centrifuge.
Combine the following in a 0.5 ml Lo-bind tube. Vortex and pulse centrifuge.
ABCDEF
ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)x _______ rxn
T4 DNA ligase buffer w/ 10 mM ATP (NEB)50 ul10 X0.2 X1 ul
PEG-400050 ul50%6%6 ul
T4 DNA ligase50 ul400 U/ul8 U/ul1 ul
Ultrapure water50 ulnana1 ul

Add 9 ul to each reaction. Vortex and pulse centrifuge.
Incubate in a thermal cycler at:

20 deg C for 30 min
65 deg C for 10 min
4 deg C hold

Fill in
40m
Combine the following in a 0.5 ml Lo-bind tube. Vortex and pulse centrifuge.
ABCDEF
ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)x _______ rxn
Isothermal amplification buffer60 ul10 X0.33 X2 ul
dNTPs60 ul25 mM0.33 mM0.8 ul
Bst 2.0 Warmstart DNA polymerase60 ul8 U/ul0.213 U/ul1.6 ul
Ultrapure water60 ulnana5.6 ul

Add 10 ul of the above mix to each reaction. Vortex and pulse centrifuge.
Incubate in a thermal cycler at:

65 deg C for 15 min
80 deg C for 15 min
4 deg C hold
Purify library
30m
Purify the libraries using a QIAGEN MinElute PCR Purification kit.
Note
Be sure to store the silica columns at 4 deg C.



Briefly...

Combine 300 ul of PB Buffer with each reaction in a 1.5 ml Lo-Bind tube. Vortex and pulse centrifuge.
Transfer the mixture to a MinElute Silica Spin Column (purple) placed inside a collection tube. Centrifuge for 1 min at 13,000 rpm in a bench-top centrifuge. Discard the flow-through.
Add 700 ul of PE Buffer to the column. Centrifuge for 1 min at 13,000 rpm in a bench-top centrifuge. Discard the flow-through.
Repeat Step 29.
Centrifuge one more time (dry) for 1 min at 13,000 rpm in a bench-top centrifuge. Place the column in a clean 1.5 ml Lo-bind tube with the lid cut off.
Add 25 ul of EB buffer to the column. Incubate 5 min at room temperature.
Centrifuge 1 min at 13,000 rpm. Add the eluate back through the column to increase yield. Incubate for 5 min at room temperature. Centrifuge 1 min at 13,000 rpm.
Transfer the eluate to a clean 0.5 ml Lo-bind tube.
Dilute the library 1 in 20 in Ultrapure water (i.e., add 1 ul of the library to 19 ul of Ultrapure water). Vortex and pulse centrifuge.
Libraries can be stored at -20 deg C until amplification. For long-term storage, store at -80 deg C.
Quant the library
2h 30m
Make up the following master mix in a 1.5 ml Lo-bind tube. Vortex and pulse centrifuge.

ABCDEF
ReagentV2C1C2V1x _______ rxn
Ultrapure water25 ulnana15.9 ul
BSA25 ul10 mg /ml0.4 mg/ml1 ul
ABI Gold PCR Buffer25 ul10 X1 X2.5 ul
MgCl225 ul25 mM2.5 mM2.5 ul
dNTPs25 ul25 mM0.25 mM0.25 ul
ABI Taq Gold DNA polymerase25 ul5 U/ul0.05 U/ul0.25 ul
SYBR Green25 ul5 X0.12 X0.6 ul
IS725 ul10 uM0.2 uM0.5 ul
IS825 ul10 uM0.2 uM0.5 ul
Assay A master mix

Make up the following master mix in a 1.5 ml Lo-bind tube. Vortex and pulse centrifuge.

ABCDEF
ReagentV2C1C2V1x __16___ rxn
Ultrapure water25 ulnana15.9 ul254.4 ul
BSA25 ul10 mg /ml0.4 mg/ml1 ul16 ul
ABI Gold PCR Buffer25 ul10 X1 X2.5 ul40 ul
MgCl225 ul25 mM2.5 mM2.5 ul40 ul
dNTPs25 ul25 mM0.25 mM0.25 ul4 ul
ABI Taq Gold DNA polymerase25 ul5 U/ul0.05 U/ul0.25 ul4 ul
SYBR Green25 ul5 X0.12 X0.6 ul9.6 ul
CL10725 ul10 uM0.2 uM0.5 ul8 ul
CL10825 ul10 uM0.2 uM0.5 ul8 ul
Assay B master mix

Add 24 ul of master mix to the corresponding PCR tubes. Pulse centrifuge the tubes.
Add 1 ul of DNA sample to the corresponding PCR tubes according to the scheme below. Pulse centrifuge the tubes.


ABCD
PCR NTCCL105_106_STD 10^3dsLib001 NeatdsLib005 Neat
PCR NTCCL105_106_STD 10^3dsLib001 1in20dsLib005 1in20
CL105_106_STD 10^6CL105_106_STD 10^2dsLib002 Neat...etc.
CL105_106_STD 10^6CL105_106_STD 10^2dsLib002 1in20
CL105_106_STD 10^5dsCL104 +VE NeatdsLib003 Neat
CL105_106_STD 10^5dsCL104 +VE 1in20dsLib003 1in20
CL105_106_STD 10^4dsNTC -VE NeatdsLib004 Neat
CL105_106_STD 10^4dsNTC -VE 1in20dsLib004 1in20
Assay A Plate set-up

AB
0.1 uM CL104_duplex 1/500CL105_106_STD 10^4
0.1 uM CL104_duplex 1/500CL105_106_STD 10^4
PCR NTCCL105_106_STD 10^3
PCR NTCCL105_106_STD 10^3
CL105_106_STD 10^6CL105_106_STD 10^2
CL105_106_STD 10^6CL105_106_STD 10^2
CL105_106_STD 10^5
CL105_106_STD 10^5
Assay B Plate set-up

Take the strip tubes to a post-PCR space. Place in thermal cycler and run the following program:

95 deg C for 10 min

Followed by 50 cycles of:
95 deg C for 30 sec
60 deg C for 30 sec
72 deg C for 30 sec
Electrophorese 10 ul of the PCR product from the libraries (not standards) and controls on a 2% agarose gel.

Protocol
2% Agarose Gel Electrophoresis
CREATED BY
Alicia Grealy

Make up 2 L of 1X TAE buffer:
50 ml of 40X TAE buffer
1950 ml of MilliQ water

Mix by inversion.
Using an electronic balance, weigh out 2.2 g of agarose powder on to a weigh boat using a spatula.
Note
Note that gel concentration can be adjusted. The more concentrated the gel, the greater the resolution of small fragment sizes.

Transfer the powder to a 200 ml conical flask.
Using the graduated measurng cylinder, measure out 110 ml of 1xTAE buffer. Add to the conical flask containing the agarose powder. Swirl the flask gently to mix.
Microwave the flask uncovered for 1 minute.

Safety information
A lid can loosly be placed over the flask but DO NOT tighten--allow steam to escape. Do not microwave for more than 1 minute at a time.

Do not fill flasks or beakers/Schott bottles more than half full with liquid!

Remove the flask from the microwave using oven mitts and swirl gently.
Safety information
The liquid is boiling! Use oven mitts to handle flask. Do not put your face over the opening to the flask as liquid can splash out!

Microwave the flask for a further minute but remove from the microwave if the agarose appears to boil excessively. Swirl to mix and examine near a light source to ensure the agarose has melted. Allow to cool for 5 minutes.
Place the gel casting tray into a rubber vice that will seal the ends tightly, or tape the ends with masking tape.
Place the assembly on a flat bench and use the spirit level to check it is level--adjust if needed.
Place a 20-well comb into the casting tray.
When the flask is cool to the touch, add 5 ul of SYBR Safe and swirl gently to mix. Avoid generating bubbles.
Safety information
Wait until the liquid is warm (not boiling) to cast the gel, or the tray may crack!

Pour the liquid gel slowly into the casting tray. Pop any bubbles that have formed using a clean pipette tip.
Let the gel set for 20-30 minutes at room temperature.
Allow residual gel to set in the flask, then scrape into the bin. Fill the flask half full with water and microwave until the water boils. Pour the water down the sink and clean the flask using a bottle brush.
When the gel is set, remove the combs gently.
Place the casting try and gel in the electrophoresis tank.
Fill the electrophoresis tank with 1 X TAE buffer to the fill line indicated on the tank.
Pipette 3 ul of 50 bp DNA ladder into the first well of the gel.

Note
The recommended volume will depend on the concentration of the ladder. Check the manufacterer's recommendations. If the ladder is not pre-mixed with loading dye, be sure to add 1-2 ul of loading dye before loading into the gel.

Place some Parafilm across a 96-well PCR plate rack and press down firmly to create small wells.
For each sample, pipette 1-2 ul of loading dye onto the Parafilm, taking care not to pierce the Parafilm.
Mix 10 ul of PCR product with the loading dye by pipetting gently up and down.

Transfer the 12 ul of PCR product/loading dye to the wells of the gel, taking care not to pierce the bottom of the well with the pipette tip.
Note
The volume each well can take will depend on the size of the comb used. Be sure not to overload the wells or product will float out the top of the well.

Place the lid on the gel tank and plug the electrodes into the appropriate power slots. Ensure the positive electrode is at the base of the gel.



Safety information
Take care when working with electricity and water!

Check electrical cords of all equipment and ensure none are damaged and that cords are not a tripping hazard. Do not use if the electrical cord is damaged in any way. Tag the instrument with warnings, make the area safe, and notify your line manager and anyone else in the immediate area that may be affected.

Use electrical equipment indoors only in an area free of explosive material, corrosive gas, powerful vibrations, direct exposure to sunlight, and temperature fluctuations. Use in a space where cables will not come into contact with liquids, be manually damaged, or interfere with other workplace operations.

Do not use electrical equipment with any other power adapter or cord than the one supplied.

Switch the power pack on a set the voltage to 80 V and the time to 1 hr and 10 min.
Note
Note that the voltage and time can be adjusted to suit what you are running on the gel. For amplicons (one small product), I will run the gel at 96 V for 30-40 min. For shotgun libraries, I will run the gel as above. The lower the voltage and longer it is run, the greater the separation of fragments will be.

Press 'Run' or 'Start' on the power pack and check to see that bubbles are rising from electrodes.
When the run is over, switch of the power pack, remove the lid, and remove the gel from the tank, taking care not to let it slide off the tray.
Safety information
Do not remove the lid to the electrophoresis tank until the power pack is switched off.

Place the gel on the UV transilluminator and photograph using the attached camera. Follow the manufactuerer's instructions to use the equipment.


Safety information
Take care working with UV. You should have UV safety training. Do not open the transilluminator while the UV is on! Use signage to warn others when the UV is on.

Discard the gel into a designated biohazard bin, and clean the UV dock with 70% ethanol.
Dispose of used tips into a designated sharps container.
Dispose of gel waste into a biohazard bag.
Used combs, beakers, flasks, and tray should be washed with warm water and placed on a rack to dry.
Gloves and chemical waste should be sealed in a biohazard bag for incineration.
Use the CT values from the qPCR to generate a standard curve for the standards in order to calculate how many template copies are present in each library. The positive control is used to calculate the efficiency of the library prep:

(# Copies of CL104 from Assay A / # copies CL104 from Assay B) * 100


Expected result
Library preparation efficiency should typically be between 30-70% according to Gansauge and Meyer (2013).

Molecule counts from the library preparation blank control should be less than 1x10^9, usually 1x10^8.

The relationship between input volume of DNA extract and out of library molecules should be linear. If it is not, either too much DNA was used for library preparation or the DNA extract is inhibited. Gansauge et al. (2017) recommend to create a few preps with various input amounts to determine this; however, most of the time, this is not feasible because it is expensive to prepare multiple libraries for one sample.

The Neat and 1in20 dilution of libraries should show be approximately 4.33 cycles apart. If they are not, there might be too much input DNA in the qPCR. Dilute futher and run the qPCR to get a more accurate estimate of library molecules.

Insert sizes typically range from 20-120 bp.

Indexing PCR will typically require 10-15 cycles of amplification.



This assay is also used to determine the number of cycles to give the indexing PCR, which needs to be stopped during the linear phase.
Index/amplify the library
2h 30m
Make up the following master mix in a 1.5 ml Lo-bind tube. Ensure to prepare enough master mix for 4 reactions per library plus pipetting error. Vortex and pulse centrifuge.

Note
Remember that each library will have it's own unique combination of forward and reverse indexing primers. Do not add these to the master mix, but add each to each reaction individually! Take great care not to cross-contaminate primers: only have one tube open at a time. Use qPCR tubes with individual capped lids (not strip lids!).

Note
Ideally, indexing combinations should never be reused in the lab. Be sure to follow Illumina's recommendations when chosing primer combinations (e.g., ensure adequate diversity in the bases, ensure each is at least 3 bp different from each other, don't use indexes that will begin with two dark cycles, etc.). For instance, the NextSeq cannot read "GG" a the start of an index (so indexes should not end in "CC" as they are sequenced in the reverse complement).


ABCDEF
ReagentV2C1C2V1x _____ rxn
Ultrapure water25 ulnana10.9
BSA25 ul10 mg /ml0.4 mg/ml1 ul
ABI Gold PCR Buffer25 ul10 X1 X2.5 ul
MgCl225 ul25 mM2.5 mM2.5 ul
dNTPs25 ul25 mM0.25 mM0.25 ul
ABI Taq Gold DNA polymerase25 ul5 U/ul0.05 U/ul0.25 ul
SYBR Green25 ul5 X0.12 X0.6 ul
P5_indexing_primer25 ul10 uM0.2 uM0.5 ulDon't add to master mix
P7_indexing_primer25 ul10 uM0.2 uM0.5 ulDon't add to master mix

Add 19 ul of master mix to the corresponding PCR tubes. Pulse centrifuge the tubes.
Add 0.5 ul of the corresponding forward indexing primer to the appropriate reaction tube. Pulse centrifuge the tubes.
Add 0.5 ul of the corresponding reverse indexing primer to the appropriate reaction tube. Pulse centrifuge the tubes.
Add 5 ul of DNA sample to the corresponding reaction tubes according to the scheme below. Pulse centrifuge the tubes.

e.g.,
ABCDEF
dsLib001dsLib003dsLib005
dsLib001dsLib003dsLib005
dsLib001dsLib003dsLib005
dsLib001dsLib003dsLib005
dsLib002dsLib004...etc.
dsLib002dsLib004
dsLib002dsLib004
dsLib002dsLib004


Take the strip tubes to a post-PCR space. Place in qPCR machine and run the following program:

95 deg C for 10 min
Followed by _________ cycles of:
95 deg C for 30 sec
60 deg C for 30 sec
72 deg C for 30 sec


Note
Note that the number of cycles to give should be determined based on the Assay A qPCR: stop while amplification is in the linear phase (before plateau). This PCR can be performed on a standard thermal cycler (and with your reagents of choice) but I prefer to run it on a qPCR as Assay A and B so I can monitor the amplification in real time. Ensure that you use a high-fidelity polymerase. You can use a proof-reading polymerase if doing standard PCR but do not use one with qPCR.

Purify the libraries
Pulse centrifuge the PCR tubes. Combine replicate PCR reactions into a 1.5 ml Lo-bine Safelock tube. Vortex and pulse centrifuge.
Purify the libraries using SeraMag Speed Beads or SeraMag Select using a 1.6X beads : reaction volume (i.e., 160 ul). Follow the guidelines below:


Elute in 35 ul of Ultrapure water.
Quantitate the libraries
Dilute the libraries 1 in 10 in Ultrapure water (i.e., 1 ul library in 9 ul Ultrapure water).
Use a LabChip GXII or equivalent fragment analyser (HiSense kit) to measure the molarity of the libraries between 160-500 bp.



Expected result
Libraries will be insert size + 136 bp, so the smallest fragments of interest will be ca. 166 bp (30 bp insert).

Pool libraries
Pool libraries in equimolar concentrations such that the total amount of DNA per library does not exceed 500-1000 ng.
Note
If you are proceeding directly with hybridisation capture, STOP HERE and move to (e.g.) the protocol below. Try to pool libraries such that the total amount of DNA per library does not exceel 500 ng (the recommended input amount per capture).

Protocol
hyRAD (Suchan et al. 2016; Grealy et al.)
CREATED BY
Alicia Grealy

Preparation

Note
Perform all reaction set-up steps in a reagent-only pre-PCR space inside a dedicated ultraclean environment. Add DNA and subsequent master-mixes to the reaction, and perform wash steps, in a separate pre-PCR space.

"Suit up" in this order: hair net, nitrile gloves, facemask, coveralls, gumboots, booties, second pair of gloves.
Prepare the space by decontaminating surfaces with 10% household bleach followed by 70% ethanol. UV irradiate pipettes and racks. Racks should be bleached between subsequent uses and UV irradiated.
Ensure ice is available. Thaw reagents on ice as needed. Keep enzymes on ice at all times. Do not vortex enzymes to mix but mix by flicking the tube gently. Pulse centrifuge all reagents before opening.
Label tubes.

TubeQtyFor ...
1.5 ml Lo-bind Safelock tube110 mM Tris-HCl
1.5 ml Lo-bind Safelock tube110X Annealing Buffer
0.5 ml Lo-bind Safelock tube2P1 and P2 adapter oligos
0.2 ml Lo-bind PCR tube1Annealing P1 and P2 adapter oligos

Prepare all necessary buffers and UV decontaminate where appropriate.
Note
Aliquot 5X SYBR into 500-ul batches and store at -20 deg C in foil.

Aliquot dNTPs into 50-ul batches and store at -20 deg C.

BufferReagentVolume to addFinal concentration in solution
10 mM Tris-HCl1 M Tris-HCl10 ul10 mM
Ultrapure water990 ulna
10 X Annealing Buffer1 M Tris-HCl100 ul100 mM
5 M NaCl100 ul500 mM
0.5 M EDTA20 ul10 mM
Ultrapure water780 ulna


Before resuspending oligos, pulse centrifuge to collect the pellet at the bottom of the tube. Add the appropriate buffer (see Materials) and vortex thoroughly. Store at -20 deg C. Dilute out the working concentrations (below) and store at -20 deg C when not in use. Thaw on ice. Vortex and pulse centrifuge after each thaw. Before beginning library preparation, make sure you have enough of each working stock prepared!

Note
Note: Do not store oligos and adapters in the same box as enzymes or reagents!

The standards should be diluted in a totally different space, such as a teaching lab to ensure it does not contaminate the lab at extremetly high concentration.

Also take extreme care with the positive control oligo as it will become a template for library preparation!

Working stockReagentVolume to add
10 uM P5_Indexing_Primer100 uM Stock50 ul
Ultrapure water450 ul
10 uM P7_Indexing_Primer100 uM Stock50 ul
Ultrapure water450 ul

Pre-program the thermal cycler.
Combine the following in a 0.2 ml Lo-bind PCR tube. Vortex and pulse centrifuge.

ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)
P1.1 adapter oligo (EcoRI)100 ul100 uM10 uM10 ul
P1.2 adapter oligo (EcoRI)100 ul100 uM10 uM10 ul
Annealing buffer100 ul10 X1 X10 ul
Ultrapure water100 ulnana70 ul

Combine the following in a 0.2 ml Lo-bind PCR tube. Vortex and pulse centrifuge.

ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)
P2.1 adapter oligo (MspI)100 ul100 uM10 uM10 ul
P2.2 adapter oligo (MspI)100 ul100 uM10 uM10 ul
Annealing buffer100 ul10 X1 X10 ul
Ultrapure water100 ulnana70 ul

Incubate in a thermal cycler at:
95 deg C for 1 min
Cool at a rate of 0.1 deg C / sec until the solution reaches 20 deg C

Store at -20 deg C.
Enzymatic digestion
Label tubes.

TubeQtyFor ...
1.5 ml Lo-Bind Safelock tube1Step 2.2 Master mix
0.2 ml Lo-Bind PCR tube# of samplesEnzymatic digestion for samples

Combine the following in a 1.5 ml Lo-bind Safelock tube. Vortex and pulse centrifuge.
ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)
CutSmart Buffer (NEB)50 ul10 X1 X5 ul
EcoRI-HF (NEB)50 ul20 U/ul0.4 U/ul (20 U)1 ul
MspI (NEB)50 ul20 U/ul0.4 U/ul (20 U)1 ul
Ultrapure water50 ulnana33 ul

Note
EcoRI-HF (NEB) is active for >8 hr.
MspI (NEB) is active between 2-4 hr.

Note: This reaction has been scaled up to a 50 ul reaction as NEB recommends not leaving 10 ul reactions longer than 1 hr due to evaporation. Also, 10-20 U fo enzyme is recommended to digest 1 ug of DNA in a reaction volume of 50 ul for 1 hr. So, to ensure complete digestion of 1 ug of genomic DNA, 20 U of each enzyme is used n a reaction volume of 50 ul for 4 hr. MspI is not active beyond 4 hr. Also, the enzyme volume should not exceed 10% of the total reaction volume to prevent star activity due to excess glycerol.

Consider performing several reactions to obtain enough DNA for quality control along the way. I have started with 4 ug of DNA (split into 4 reactions--two DNA extracts performed in duplicate).

The ddRAD protocol recommends NOT to heat-denature restriction enzymes as they will be removed ruing the SPRI bead cleanup that follows below.


Add 40 ul of master mix to 10 ul of DNA (at 100 ng/ul ca. 1000 ng total) in a 0.2 ml Lo-bind PCR tube. Vortex and pulse centrifuge.
Note
Use high-quality DNA: quantify the concentration using the Qubit 3.0 fluorometer BR kit following the manufacturer's instructions:


Estimate the purity of the DNA using a NanoDrop spectrophotometer, following the manufacturer's instructions:


Note: do not pay attention to the DNA quanitity proveided by the NanoDrop or fragment analyser--the Qubit is much more accurate as it measures double-stranded DNA only.

Run the DNA on a fragment analyser or gel electrophoresis to determine the fragment length distribution:

Protocol
CREATED BY
Alicia Grealy








Expected result
DNA needs to be 100 ng/ul in 10 ul volume (i.e., 1 ug). Dilute to the sample to this concentration in Ultrapure water if needed.

e.g., I typically begin with samples that measure 1100 ng/ul in 100 ul (110 ug total):
In the example below, sample MD#033 was 1000 ng/ul in 100 ul
MD#034 was 1100 ng/ul in 100 ul

Pure DNA should have a 260/280 ratio of between 1.8-2.0 and a 230/260 ratio of 2.0-2.2. If the DNA is not pure, consider cleaning the neat extract using your method of choice (e.g., sodium-acetate/ethanol precipitation, etc.)

Fresh tissue should yield a high molecular weight band on an agarose gel (i.e., above 10 kb), with minimal smearing (as smearing indicates degradation).


Figure 1. An example of decently high-quality DNA extracts run on a 2% agarose gel electrophoresis (@ 80V for 1 hr 10 min), though there is some degradation.


Note
Add the DNA in a physically separate space, suitable for 'modern' DNA (i.e., NOT inside an ultraclean environment).

Incubate in a thermal cycler at:
37 deg C for 4 hr
Hold at 4 deg C
Combine any replicates.
SPRI bead clean-up

Purify the libraries using SeraMag Speed Beads or SeraMag Select using a 2X beads : reaction volume (i.e., 160 ul). Follow the guidelines below:

https://www.gelifesciences.co.jp/catalog/pdf/SeraMagSelect_UserGuide.pdf

Elute in 20 ul of 10 mM Tris-HCl.
Note
This step is to remove the enzymes only. To avoid losing product, use a ration of 1.8-2X beads, which should keep everything above 100 bp without too much yield loss.

Qubit

Measure the concentration using the Qubit HS kit following the manufacturer's instructions.

Expected result
Expect a loss of around 3%.

e.g., MD#034 = 97 ng/ul in 20 ul (or 1940 ng total). 2 ug of this sample was input into the reaction, so the loss is approximately 3%.

Agarose gel electrophoresis

Electrophorese 2 ul of product (200-500 ng in 5-10 ul) on a 2% agarose gel.

Protocol
CREATED BY
Alicia Grealy

Expected result
Digested DNA should show a smear rather than a large band. However, some high-molecular weight fragments may remain but they won't be the same size as previously--it's just difficult to resolve these fragments on a gel (i.e., it is difficult to distinguish between 30,000 bp and 10,000 bp on this kind of gel).

Note: I have tested putting more enzyme into the reaction the results look the same.

Figure 2. An example of DNA that has undergone the restriction digest with EcoRI-HF and MspI using the reaction conditions described above.


Adapter ligation
Label tubes.
TubeQtyFor ...
1.5 ml Lo-Bind Safelock tube1Step 3.2 Master mix
0.2 ml Lo-Bind PCR tube# of samples x 2Reactions, two per sample

Combine the following in a 1.5 ml Lo-bind Safelock tube. Vortex and pulse centrifuge.
ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)
CutSmart Buffer (NEB)20 ul10 X1 X2 ul
P1 adapter20 ul10 uM0.5 uM1 ul
P2 adapter20 ul20 uM1 uM1 ul
ATP20 ul100 mM1 mM0.2 ul
T4 DNA ligase20 ul400 U/ul20 U/ul (400 U)1 ul
Ultrapure water20 ulnana5.8 ul

Note
Peterson et al. suggests to use 2-10 fold adapters : sticky ends in a 40 ul reaction volume. Based on the approximate average fragment size and the # ng input of DNA, calculate the molarity of the DNA ends using:


e.g., 500 ng of 275 bp DNA has 5.883 pmol DNA ends. So, for 10X adapters we would need ca. 30 pmol DNA ends per adapter, which, at ~45 bp, would be about 400 ng.

Molecular weight of P1 adapter = 32.7507 kDa. 10 uM P1 = 327.507 ng/ul
Molecular weight of P2 adapter = 18.3674 kDa. 20 uM P2 = 367.348 ng/ul

So using 1 ul of each at these concentrations should be enough for this quantity of input DNA.

e.g., if we have 14 ul of digested DNA at 97 ng/ul and we perform the ligation in duplicate, that would make the input 679 ng. If we estimate the average fragment length of the smear at 800 bp, this would be 2.7 pmol DNA ends. Even if we overestimated the fragment length (and it is actually 400 bp), the above amounts of adapter would still be in excess.

Adapter dimer will be removed with the size selection so it shouldn't be too bad if the adapters are in excess.


Add 11 ul of the above master mix to 9 ul of digested DNA in a 0.2 ml Lo-bind PCR tube. Vortex and pulse centrifuge.
Incubate in a thermal cycler at:
16 deg C for ca. 20 hr (16 hr - overnight)

Combine any replicates.
Note

NEB suggest to perform the ligation overnight.

SPRI bead clean-up

Purify the libraries using SeraMag Speed Beads or SeraMag Select using a 2X beads : reaction volume (i.e., 160 ul). Follow the guidelines below:

https://www.gelifesciences.co.jp/catalog/pdf/SeraMagSelect_UserGuide.pdf

Elute in 21 ul of 10 mM Tris-HCl.
Note
This step is to remove the T4 DNA ligase, adapter dimer (ca. 90 bp) and unligated adapter (55 and 35 bp).

At this stage we "could" remove some of the fragments that are not of interest. A right-sided selection followed by a left-sided selection can be sued to select fragments within a certain range. Potentially a simple right-sided selection may be beneficial here because it will remove larger fragments without such a loss of yield of smaller fragments that may be of interest. Trying to remove small fragments of litte interest (e.g. <100 bp) may result in a substantial loss of yield for those in the target range (180-300 bp).

For a right-sided selection, a ratio of 0.6 X beads should remove most fragments >500 bp without substantial reduction in yield in the 100-300 bp size range.

For a left sided-selection, a ratio of 1.6 X beads should remove most fragments <100 bp without a substantial reduction in yield in the 100-300 bp size range.

BUT this would only really be beneficial if doing the amplification BEFORE size-selection.

Qubit

Measure the concentration using the Qubit HS kit following the manufacturer's instructions.

Expected result
Expect approximately 30% loss of yield.

e.g., MD#034 = 37.8 ng/ul (or 945 ng total), which is a 30% loss.

qPCR quant the RAD library

Note
This step is to make sure the ligation worked and to see what sized fragments would amplify. This step could be performed with alongside standards of known concentration to calculate the number of libarary molecules output in the RAD library.

You can also run more of a serial dilution of the library to ensure the quantitation is accurate. Here, I only input 1 ul of the neat library and 1 ul of a 1 in 20 dilution.

It could be possible to amplify the RAD library with indexes and THEN perform size selection. However, I am not sure how this may bias the probe set as it has not been tested, so I follow recommendations of Suchan et al. (2016), performing the size selection BEFORE the indexing PCR/library amplification.

After initial testing, I routinely skip this step

Label tubes.
TubeQtyFor ...
1.5 ml Lo-Bind Safelock tube1Step 4.2 Master mix
8-well strip qPCR tubes 0.1 ul profile1PCR amplification


Combine the following in a 1.5 ml Lo-bind Safelock tube. Vortex and pulse centrifuge.
ReagentV2C1C2V1x _____ rxn
Ultrapure water25 ulnana15.9 ul
BSA25 ul10 mg /ml0.4 mg/ml1 ul
ABI Gold PCR Buffer25 ul10 X1 X2.5 ul
MgCl225 ul25 mM2.5 mM2.5 ul
dNTPs25 ul25 mM0.25 mM0.25 ul
ABI Taq Gold DNA polymerase25 ul5 U/ul0.05 U/ul0.25 ul
SYBR Green25 ul5 X0.12 X0.6 ul
IS725 ul10 uM0.2 uM0.5 ul
IS825 ul10 uM0.2 uM0.5 ul

Add 24 ul of master mix to the corresponding PCR tubes. Pulse centrifuge the tubes.
Dilute each library 1 in 20 (i.e., 1 ul of library in 19 ul of Ultrapure water). Vortex and pulse centrifuge.
Add 1 ul of DNA sample to the corresponding PCR tubes according to the scheme below. Pulse centrifuge the tubes.


e.g.,
PCR NTC
PCR NTC
MD#033 Neat
MD#033 1 in 20
MD#034 Neat
MD#034 1 in 20

Take the strip tubes to a post-PCR space. Place in thermal cycler and run the following program:

95 deg C for 10 min

Followed by 50 cycles of:
95 deg C for 30 sec
60 deg C for 30 sec
72 deg C for 30 sec
Agarose gel electrophoresis

Electrophorese 2 ul of product (200-500 ng in 5-10 ul) on a 2% agarose gel.

Protocol
CREATED BY
Alicia Grealy

Expected result
The longest adapter dimer will be 112 bp but most should have been removed with the SPRI bead purification. Inserts of 50 bp will be 162 bp. If there are many fragments outside the target range (180 bp insert, i.e., 272 bp with adapters or say 250-300 bp), then definitely size select BEFORE indexing/amplification. If most amplified fragments are within the desired size range, it MAY be possible to size select after indexing/library amplification, but I have not tested this, and do not know whether it would bias the probe set in a different way. It is possible that size selecting after indexing/library amplification would deplete the yield so much as to require more amplification anyway.

Figure 3. An example of the size of fragments that would be amplified from the RAD library BEFORE size selection. It does appear that ligation worked. Amplification of the neat extract does appears to be inhibited, so if quantitating the number of molecules via qPCR using a standard, perhaps run a small dilution series for each library.


Size selection using Pippin HT
Note
The maximum input into the Pippin HT is 1 ug /lane sheared genomic DNA (i.e. 75 ng/ul in 20 ul)
The minimum input into the Pippin HT is 15 ng /lane sheared genomic DNA


Depending on the total yield and concentration determined using the Qubit (see Step 3.6 above), run approximately 1 ug of DNA in 20 ul (ca. 75 ng/ul) of each samples across a lane of a PippinHT electrophoresis system (2% gel, Marker 20B), selecting fragments 272 bp in size (272 bp peak with tight range 212-332 bp--this equates to an insert size of 180 bp) and following the manufacturer's instructions:


Note
180 bp insert size / probe size was used by Suchan et al. (2016) and Schmitt et al. (2018?). It is possible to make probes smaller than this, which may be beneficial for caputuring ancient DNA, but be sure to check the restriction enzymes used will generate enough loci within this size range.

SPRI cleanup

Combine any replicates. Purify the libraries using SeraMag Speed Beads or SeraMag Select using a 2X beads : reaction volume. Follow the guidelines below:


Elute in 21 ul of Ultrapure water.
Note
This cleanup is for the purpose of buffer exchange, but also will concentrate any replicates into a smaller working volume.

Qubit

Measure the concentration using the Qubit HS kit following the manufacturer's instructions.

Expected result
Expect approximately 99% loss of yield.

e.g., 996 ng was input into the PippinHT lane for MD#033 and 9.724 ng came out (1%)

qPCR quant the size-selected RAD library

Note
This step is to make sure the size-selection worked. This qPCR could be performed alongside standards of known concentration to quantify the number of library molecules present in the RAD library after size selection.

After initial testing, I routinely skip this step.

Follow Steps 4.1 - 4.7 above to perform the qPCR if so desired.
Expected result
If the average insert size is 180 bp, then there should be a tight smear around ...

Index / amplify the RAD library


Label tubes.
TubeQtyFor ...
1.5 ml Lo-Bind Safelock tube1Step 7.2 Master mix
8-well strip qPCR tubes 0.1 ul profile1PCR amplification

Combine the following in a 1.5 ml Lo-bind Safelock tube. Vortex and pulse centrifuge. Ensure to prepare enough master mix for multiple reactions per library plus pipetting error.
Safety information
If you are not interested in sequencing the probes at all, then you can replace the indexing primers with IS7 and IS8 primers that will just amplify the library. If you aren't interested in knowing which probes came from which extract, then all reactions may be amplified with the same indexing primers.

Note
I have typically performed the indexing / library amplification in quadruplicate reactions, using 5 ul of library per reaction (using the up whole library). You can input less DNA into each reaction and perform more replicates if you desire more DNA at the end. This will mean you have more clonal probes, but that is not too much of an issue here because we do want several copies of each probe. You can also perform more cycles, though having little DNA and increasing the number of cycles can generate amplification artefacts. Typically I will perform 30 cycles, just enough to take the reaction to plateau.

Note
Remember that each library will have it's own unique combination of forward and reverse indexing primers. Do not add these to the master mix, but add each to each reaction individually! Take great care not to cross-contaminate primers: only have one tube open at a time. Use qPCR tubes with individual capped lids (not strip lids!).

Note
Ideally, indexing combinations should never be reused in the lab. Be sure to follow Illumina's recommendations when chosing primer combinations (e.g., ensure adequate diversity in the bases, ensure each is at least 3 bp different from each other, don't use indexes that will begin with two dark cycles, etc.). For instance, the NextSeq cannot read "GG" a the start of an index (so indexes should not end in "CC" as they are sequenced in the reverse complement).


ReagentV2C1C2V1x _____ rxn
Ultrapure water50 ulnana29.5 ul
KAPA High Fidelity Buffer50 ul5 X1 X10 ul
P5_indexing_primer50 ul5 uM0.2 uM2 ulDo not add to master mix
P7_indexing_primer50 ul5 uM0.2 uM2 ulDo not add to master mix
KAPA HiFi Hot Start DNA Polymerase50 ul1 U/ul0.02 U/ul1 ul
dNTPs50 ul25 uM0.25 uM0.5 ul

Add 41 ul of master mix to the corresponding PCR tubes. Pulse centrifuge the tubes.
Add 2 ul of the corresponding forward indexing primer to the appropriate reaction tube. Pulse centrifuge the tubes.
Add 2 ul of the corresponding forward indexing primer to the appropriate reaction tube. Pulse centrifuge the tubes.
Add 5 ul of purified size-selected RAD library to the corresponding PCR tubes according to the scheme below. Pulse centrifuge the tubes.

Note
The number of ng of library input into each reaction for me is typically 1.25 - 2.21 ng. This is perhaps too little DNA for the number of cycles given, and may have generated an artefact. Potentially aim for 5-10 ng if possible.


e.g.,
MD#033
MD#033
MD#033
MD#033
MD#034
MD#034
MD#034
MD#034

Take the strip tubes to a post-PCR space. Place in thermal cycler and run the following program:

98 deg C for 10 min

Followed by 30 cycles of:
985 deg C for 20 sec
60 deg C for 30 sec
72 deg C for 40 sec

Then a final extension of:

72 deg C for 10 min
Pool replicate reactions into a 1.5 ml Lo-bind Safelock tube. Vortex and pulse centrifuge.
SPRI bead clean-up

Purify the libraries using SeraMag Speed Beads or SeraMag Select using a1.4X beads : reaction volume. Follow the guidelines below:


Elute in 40 ul of Ultrapure water.
Note
This cleanup is to remove PCR reagents and primer dimer, and to concentrate the replicates. Dimer should be around 160 bp. Fragments of interest are approximately 340 bp. This ratio of beads should remove almost everything below 200 bp.

Qubit

Measure the concentration using the Qubit HS kit following the manufacturer's instructions.

Expected result
Expect amplification to increase the DNA about 250-300 X.

e.g., Approximately 9 ng of MD#033 input across 4 PCR reactions turned into 2392 ng total, so yield increased 265-fold.

Approximately 5 ng of MD#034 input across 4 PCR reactions turned into 1520 ng total, so yield increased 304-fold.

Agarose gel electrophoresis

Electrophorese 5 ul of product (200-500 ng in 5-10 ul) on a 2% agarose gel.

Note
For any gel steps, a fragment analyser platform may alternatively be used, but I have found it to be much more straight forward to perform a gel.


Protocol
CREATED BY
Alicia Grealy

Expected result
There should be a tight smear around a peak of 340 bp with little product below 200 bp. Insert sizes of 0 bp will be at 160 bp. Indexing dimer should be at 115 bp, but the purification should have removed most of this.

e.g.,
Figure 4. A large band can be seen around 350 bp, however, there is also a larger fragment above 450 bp present. This may be PCR artefact from too many cycles given a small input of DNA (see Belt and Demarini, 1991). This was not investigated further.

Use a LabChip GXII or equivalent fragment analyser (HiSense kit) to measure the molarity of the libraries.


Alternatively, use the Qubit concentration and the average fragment size seen on the gel to estimate the molarity of the libraries:

Pool amplified libraries
Label tubes.
TubeQtyFor ...
1.5 ml Lo-Bind Safelock tube1Pooled RAD library
1.5 ml Lo-Bind Safelock tube1Aliquot of RAD library for sequencing

Pool libraries in equimolar concentrations such that the total volume is is approximately 100 ul.
Expected result
e.g., Combine 35 ul of MD#034 with 31.01 ul of MD#033. The total ng will be 3184.4 ng, the concentration will be 48.24 ng/ul.

Aliquot 20 ul of the pooled RAD library into a new 1.5 ml Lo-bind Safelock tube for future sequencing. Store at -20 deg C. See Steps 58-63 in the following protocol to quantitate and sequence the final RAD library.


Adapter removal
Label tubes.
TubeQtyFor ...
1.5 ml Lo-Bind Safelock tube1Step 9.2 master mix
0.2 ml Lo-Bind PCR tube1 per 1 ug DNAAdapter removal reaction

Combine the following in a 1.5 ml Lo-bind Safelock tube. Vortex and pulse centrifuge.
Note
Perform enough replicate reactions for each 1 ug of DNA.

ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)x ______ rxn
CutSmart Buffer (NEB)50 ul10 X1 X5 ul
MspI50 ul20 U/ul0.4 U/ul (20 U)1 ul
Ultrapure water50 ulnana25.4 ul

Aliquot 31.4 ul of the above master mix into 0.2 ml Lo-bind PCR tubes.
Add 18.6 ul (1 ug) of pooled purified RAD library to each tube. Vortex and pulse centrifuge.
Note
Remember to adjust the water volume in the reactions to accomodate the volume of library added to the reaction.

Incubate the reactions in a thermal cycler at:

37 deg C for 4 hr

Combine the replicates.
SPRI bead clean-up

Purify the libraries using SeraMag Speed Beads or SeraMag Select using a 2X beads : reaction volume. Follow the guidelines below:


Elute in 30 ul of Ultrapure water.
Note
This cleanup is simply to remove the cut-off adapters (68 bp).

Qubit

Measure the concentration using the Qubit HS kit following the manufacturer's instructions.

Expected result
Expect a loss of about 56%.

e.g., After adapter removal, MD#033/MD#034 RAD library was 59.8 ng/ul or 1794 ng total. Before we had 3184 ng--so about 56% was lost.

Agarose gel electrophoresis

Electrophorese 5 ul of product (200-500 ng in 5-10 ul) on a 2% agarose gel.

Protocol
CREATED BY
Alicia Grealy

Expected result
50-53 bp are being cut-off during the adapter removal process, so the peak should be between 296-299 bp.

e.g.,
Figure 5. The RAD library after adapter removal. It is the right size.


In-vitro transcription and biotinylation
Label tubes.
TubeQtyFor ...
1.5 ml Lo-Bind Safelock tube1Step 10.3 master mix
0.2 ml Lo-Bind PCR tube# reactionsTranscription/biotinylation reaction
0.2 ml Lo-Bind PCR tube2Aliquots of TURBO DNase and SuperaseIn RNAse inhibitor
1.5 ml Lo-Bind Safelock tube1Combine probes for cleanup
RNeasy mini spin column1Purification
1.5 ml Lo-Bind Safelock tube with the lid cut off1Elution
1.5 ml Lo-Bind Safelock tube1Final tube for probes
0.5 ml Lo-Bind Safelock tubeDepends on total ug of probes6-ul aliquots of probes

Aliquot 10 ul of TURBO DNAse and 10 ul of SuperaseIn RNAse inhibitor into separate 0.2 ml Lo-bind tubes.
Combine the following in a 1.5 ml Lo-bind Safelock tube. Vortex and pulse centrifuge.
Note
Perform enough replicate reactions to transcribe all the library left into probes (inputting 500 ng of library per reaction).

ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)x ______ rxn
Reaction Buffer (HiScribe kit)20 ul10 X0.75 X1.5 ul
dATP20 ul100 uM7.5 uM1.5 ul
dCTP20 ul100 uM7.5 uM1.5 ul
dGTP20 ul100 uM7.5 uM1.5 ul
dUTP20 ul100 uM5 uM1 ul
biotin-UTP20 ul10 mM2.5 mM5 ul
T7 RNA polymerase mix20 ul??1.5 ul
Ultrapure water20 ulnanaAdjust depending on the volume of library added

Note
Typically I do not add water to the reaction.

Aliquot 13.5 ul of the above mater mix to 0.2 ml Lo-bind PCR tubes. Bring all tubes to a post-PCR space, including teh aliquots made in Step 10.2.
Concentrate the "probe set" (i.e., the pool RAD library with the adapters cut off) such that roughly 500 ng in 6.5 ul can be added per reaction using a SpeedVac, following the manufacturer's instructions:

Expected result
e.g., After quanting and the gel, I had 1495 ng of MD#033/MD#034 in 25 ul. I concentrated this to 16.5 ul (i.e., 90.6 ng/ul). Then I added 6.5 ul into two replicate transcription/biotinylation reactions (i.e., 589 ng was input into dupllicate reactions).

Add 6.5 ul of the "probe set" (ca. 500 ng) to each reaction. Vortex and pulse centrifuge.
Incubate in a thermalcycler at:

37 deg C for 16 hr
In the last 30 min, add 2 ul of TURBO DNase (2 U/ul, or 4 U for up to 10 ug). Pipette up and down to mix.

Combine replicate reactions in a 1.5 ml Lo-bind tube. Top up to 100 ul with RNase-free water.
Cleanup using an RNeasy Mini Kit

Note
This step is to remove reagents.


Follow the manufacturer's instructions to purify the probes using an RNeasy Mini Kit:


Elute in 60 ul RNase-free water.
Add 2.5 ul of SUPERase-IN RNAse Inhibitor (20 U/ul) to the eluate. Flick to mix and pulse centrifuge.
Qubit

Measure the concentration of the probes using the Qubit RNA kit following the manufacturer's instructions.

Expected result
The HiScribe kit suggests that 1 ug DNA --> 10 ug, but after inputting 1.2 ug DNA I got ~40 ug:

e.g., Measuring the concentration of a 1 in 2 and a 1 in 10 dilution of the probes (MD#033/MD#034) I estimate the neat to be either 23.7 or 55.8 ug of RNA, respectively. Averaging those values gives approximately 39.75 ug of RNA, or enough for about 40 hybridisation capture reactions (giving each reaction 1 ug of probes).

Fragment analyse

Examine the fragment length distribution of the probes using a fragment analyser such as the LabChip GXII RNA kit (or equivalent fragment analyser) following the manufacturer's instructions:

Expected result
The probes should have a peak at about 210-239 bp (with a tight distribution perhaps from 160-500 bp length).




Dilute the RNA probes to 200 ng/ul with RNAse-free water. Aliquot into 6 ul batches in 0.5 ml Lo-bind Safelock tubes and store at -80 deg C.
Label tubes.
TubeQtyFor ...
1.5 ml Lo-Bind Safelock tube1Mineral oil aliquot
0.2 ml Lo-Bind PCR tube# capture reactions x 2Hybridisation
1.5 ml Lo-Bind Safelock tube2Step 14 and 15 master mixes

Ensure all primer stocks are pepared in the correct buffer and that enough aliquots of the working concentrations are diluted out. Vortex and pulse centrifuge.
Thaw reagents. Flick all reagents to mix and pulse centrifuge where possible.
ReagentStored at...Thaw at...
20 X SSPE4 deg CRoom temperature
500 mM EDTA4 deg CRoom temperature
50 X Denardt's Solution-20 deg CRoom temperature
10% SDS4 deg CRoom temperature
Chickent Cot-1 (HyBloc)-20 deg COn ice
FWD_blocking_primer-20 deg COn ice
REV_blocking_primer-20 deg COn ice
SUPERas-In RNAse inhibitor-20 deg COn ice
Salmon Sperm DNA-20 deg COn ice

Combine the following "BLOCKS" master mix in a 1.5 ml Lo-bind Safelock tube. Vortex and pulse centrifuge.
ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)x ______ rxn
Chicken Cot-1 (HyBloc)3.25 ul1 ug/ul0.77 ug/ul2.5 ul
Salmon Sperm DNA3.25 ul10 ug/ul0.77 ug/ul0.25 ul
FWD_blocking_primer3.25 ul200 uM15.4 uM0.25 ul
REV_blockg_primer3.25 ul200 uM15.4 uM0.25 ul
"BLOCKS" master mix

Aliquot 3 ul of the BLOCKS master mix into 0.2 ml Lo-bind tubes, one for each capture reaction.
Combine the following "HYBS" master mix in a 1.5 ml Lo-bind Safelock tube. Vortex and pulse centrifuge.
ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)x ______ rxn
SSPE20 ul20 X9 X9 ul
EDTA20 ul0.5 M0.0125 M0.5 ul
Denhardt's solution20 ul50 X8.75 X3.5 ul
SDS20 ul10 %0.25 %0.5 ul
SUPERase-In RNase inhibitor20 ul20 U/ul1 U/ul1 ul
"HYBS" master mix

Aliquot 14.5 ul of the HYBS master mix into 0.2 ml Lo-bind tubes, one for each capture reaction.
Bring all the tubes to the post-PCR space.
Pre-program the thermal cycler:

95 deg C for 5 min
60 deg C for 5 min
60 deg C for hold
Note
Recommendations for the hybridisation temperature

Thaw a 6-ul aliquot of the probes from Step 10.13 on ice.
Add 5.5 ul of baits (ca. 500-1000 ng at 100-200 ng/ul) to each HYBS reaction. Flick to mix and pulse centrifuge. Place on ice.
Add 7 ul (100-500 ng) of shotgun library to the corresponding BLOCKS tube. Flick to mix and pulse centrifuge.
Note
Shotgun libraries can contain a single sample or a pool of samples...

Ideally the library should be double-indexed and purified (but not size-selected--a lot of the dimer should be washed away in the capture but it will be size-selected after the capture anyway).

The input amount of DNA is 100-500 ng in 7 ul (i.e., 14-72 ng/ul). The range is 1 ng input to up to 2 ug input DNA.

Transfer the BLOCKS tubes to a thermalcycler and start the program. Allow it to proceed through Step 1 (i.e., 95 deg C for 5 min).

When the thermalcycler reaches Step 2, transfer the HYBS tubes to the thermalcyler. Allow it to proceed through Step 2 (i.e., 60 deg C for 5 min).
When the thermalcycler reaches Step 3, transfer 18 ul from the HYBS tubes to the corresponding BLOCKS tubes. Pipette to mix. Discard the HYBS tubes.
Add 15 ul of mineral oil to the top of each reaction.
Allow the thermalcycler to proceed through Step 3 for 42 hr (i.e., 60 deg C for 42 hr).
Label tubes.
TubeQtyFor ...
50 ml Falcon tubes3Wash buffer 2, Wash buffer 2.2, Binding buffer
15 ml Falcon tubes3Aliquots for Wash buffer 2.2 and Binding buffer, and 10 mM Tris-HCl/0.05% Tween-20
1.5 ml Lo-bind Safelock tube1Aliquot for MyOne C1 Streptavidin beads
1.5 ml Lo-bind Safelock tube3 x # hybridisation reactionsEnrichment

Prepare all necessary buffers and UV decontaminate.
BufferReagentVolumeC2
Wash buffer 220 X SSC100 ul0.1 X
10% SDS200 ul0.1 %
Ultrapure water19.7 mlna
Wash buffer 2.210% SDS400 ul0.08%
Wash buffer 210 mlna
Ultrapure water39.6 mlna
Binding buffer5 M NaCl10 ml1 M
1 M Tris-HCl500 ul10 mM
0.5 M EDTA100 ul1 mM
Ultrapure water39.4 mlna
10 mM Tris-HCl, 0.05% Tween-201 M Tris-HCl500 ul10 mM
100% Tween-2025 ul0.05%
Ultrapure water49.475 mlna

Aliquot reagents for to take to the post-PCR space.
700 ul * # reactionsBinding buffer
30 ul * # reactionsMyOne C1 Streptavidin beads
35 ul * # reactions10 mM Tris-HCl/0.05% Tween-20
1600 ul * # reactionsWash Buffer 2.2

Set a water bath or thermalshaker to 55 deg C. Warm Wash buffer 2.2 to 55 deg C for 45 min.
Set a heat block to 95 deg C.
Pellet the MyOne C1 Streptavidin beads for 2 min with the magnetic rack. Discard the supernatant.
Add 200 ul * # reactions of Binding buffer to the beads. Vortex and pulse centrifuge.
Pellet the beads with the magnetic rack and discard the supernatant.
Repeat Step 34-35 two more times for a total of 3 washes.
Resuspend the beads in 70 ul * # reactions of Binding buffer.
Aliquot 70 ul of beads into a 1.5 ml Lo-bind Eppendorf tube (1 per reaction).
Warm the bead aliquots to 55 deg C in the thermoshaker/water bath for 2 minutes.
Transfer the hybridised libraries at 60 deg C to the bead aliquots. Pipette to mix.
Incubate the hybridised libraries and beads in the thermoshaker/waterbath for 30 min at 55 deg C. Agitate every 5 minutes by flicking or gently continuously shake.
Pulse centrifuge. Pellet the beads with the magnetic rack. Discard the supernatant.
Add 500 ul heated Wash Buffer 2.2 to the beads. Vortex and pulse centrifuge.
Incubate 10 min at 55 deg C in the thermoshaker/water bath. Agitate every 2 min by flicking.
Pulse centrifuge. Pellet the beads with the magnetic rack. Discard the supernatant.
Repeat the wash steps above (Steps 43-45) two more times for a total of 3 washes.
Add 30 ul of 10 mM Tris-HCl/0.05% Tween-20 to the washed beads. Resuspend by pipetting.
Incubate at 95 deg C in a heat block for 5 min.
Pellet the beads with a magnetic rack and transfer the supernatant to a clean 1.5 ml tube.




At this point you can treat with RNAseA to remove any RNA or put RNAse A in the PCR but it is not necessary as the RNA will not amplify.
Dilute the captured libraries 1 in 10 in Ultrapure water (i.e., 1 ul in 9 ul Ultrapure water). Vortex and pulse centrifuge.
Label tubes.
Thaw reagents on ice.
Ensure that all primer stocks are prepared in the correct buffer and that enough aliquots of the working concentrations are diluted out. Vortex and pulse centrifuge.
OligoReagentVolume
10 uM P5_primer100 uM P550 ul
Ultrapure water450 ul
10 uM P7_primer100 uM P750 ul
Ultrapure water450 ul

Make up the following master mix in a 1.5 ml Lo-bind tube.
ReagentV2C1C2V1x _____ rxn
Ultrapure water25 ulnana10.9
BSA25 ul10 mg /ml0.4 mg/ml1 ul
ABI Gold PCR Buffer25 ul10 X1 X2.5 ul
MgCl225 ul25 mM2.5 mM2.5 ul
dNTPs25 ul25 mM0.25 mM0.25 ul
ABI Taq Gold DNA polymerase25 ul5 U/ul0.05 U/ul0.25 ul
SYBR Green25 ul5 X0.12 X0.6 ul
P525 ul10 uM0.4 uM1 ul
P725 ul10 uM0.4 uM1 ul
Master mix for end-point PCR

Add 22.5 ul of master mix to each PCR tube following the schematic below. Pulse centrifuge the tubes.

Capture001 Neat
Capture001 1in10
Capture002 Neat
Capture002 1in10
Capture003 Neat
Capture003 1in10
PCR NTC
PCR NTC

Make up the following master mix in a 1.5 ml Lo-bind tube.


ReagentV2C1C2V1x _____ rxn
Ultrapure water25 ulnana10.9
BSA25 ul10 mg /ml0.4 mg/ml1 ul
ABI Gold PCR Buffer25 ul10 X1 X2.5 ul
MgCl225 ul25 mM2.5 mM2.5 ul
dNTPs25 ul25 mM0.25 mM0.25 ul
ABI Taq Gold DNA polymerase25 ul5 U/ul0.05 U/ul0.25 ul
SYBR Green25 ul5 X0.12 X0.6 ul
P525 ul10 uM0.4 uM1 ul
P725 ul10 uM0.4 uM1 ul
Master mix for final PCR

Add 20 ul of master mix to each PCR tube following the schematic below. Pulse centrifuge the tubes.

Capture001 NeatCapture003 Neat
Capture001 NeatCapture003 Neat
Capture001 NeatCapture003 Neat
Capture001 NeatCapture003 Neat
Capture002 Neat
Capture002 Neat
Capture002 Neat
Capture002 Neat

Pulse centrifuge the 8-well qPCR strip tubes containing the master mix. Bring to the post-PCR space.
To the end-point PCR, add 2.5 ul of both neat and 1in10 captured library to the corresponding tubes. Add 2.5 ul nuclease free water to the remaining wells as PCR no-template controls. Vortex and pulse centrifuge.
Place tubes in the thermal cycler and run the following PCR program:

95 deg C for 10 min

Followed by 50 cycles of:

95 deg C for 30 sec
60 deg C for 30 sec
72 deg C for 30 sec


When the PCR is finished, determine the optimal number of cycles to give in the final PCR to ensure libraries are not over-amplified. i.e., stop the PCR during the linear phase of amplification.
Note
This is particularly important if you performed a capture that contained a pool of samples, and why if you DO capture a pool you ensure that both forward and reverse indexes are unique (not just the combination)--over-amplification can cause tag-jumping, so if the indexes are completely unique to a sample, even if tag jumping occurs they will be thrown out becuase the erroneous combination can be identified.

This step could be performed with alongside standards of known concentration to calculate the number of library molecules output from the capture library. This could be compared to to the number of library molecules input into the capture--if the capture worked, you would expect much fewer molecules OUT of the capture than went in.

The Neat and 1in10 dilution of libraries should show be approximately 3.33 cycles apart. If they are not, there might be too much input DNA in the qPCR. Dilute futher and run the qPCR to get a more accurate estimate of library molecules.


Agarose gel electrophoresis

Run 10 ul of PCR product from the first PCR on a 2% agarose gel electrophoresis.
Protocol
CREATED BY
Alicia Grealy

To the second PCR add 5 ul of the neat library (as long as amplification was NOT inhibited in the first PCR; if amplification efficiency was poor, amplify a dilution and do more replicates). Perform enough replicates to amplify the entire captured library.

Perform Step 61 above, but stop the PCR during the linear phase of amplification as determined by the end-point PCR above.
Expected result
The number of cycles needed may be greater than was needed for the initial library amplification (before capture) but is usually between 15-20 cycles.

Combine replicates in a clean 1.5 mL Lo-bind Safelcok tube. Vortex and pulse centrifuge.
Purify

Purify the libraries using SeraMag Speed Beads or SeraMag Select using a 1.6X beads : reaction volume (i.e., 160 ul). Follow the guidelines below:


Elute in 40 ul of Ultrapure water.
Run each enriched library in duplicate across two lanes (20 ul each) of a PippinHT electrophoresis system (2% gel, Marker 20B), selecting fragments between 160-500 bp and following the manufacturer's instructions:

Purify

Combine replicates. Purify the libraries using SeraMag Speed Beads or SeraMag Select using a 2X beads : reaction volume (i.e., 160 ul). Follow the guidelines below:


Elute in 25 ul of Ultrapure water.
Qubit

Measure the concentration of the neat library and these dilutions in duplicate on the Qubit following the manufacturer's instructions.


Dilute the libraries to 5 ng/ul in Ultrapure water in a total volume of 5-10 ul.
Fragment analyse

Use a LabChip GXII or equivalent fragment analyser (HiSense kit) to measure the molarity of the libraries between 160-500 bp.



Expected result
Libraries will be insert size + 136 bp, so the smallest fragments of interest will be ca. 166 bp (30 bp insert).

Pool enriched libraries in equimolar concentrations.
Dilute the libraries 1/2, 1/5, 1/10 in Ultrapure water (i.e., create a serial dilution in 10 ul volume).
Qubit

Measure the concentration of the neat library and these dilutions in duplicate on the Qubit following the manufacturer's instructions.

Fragment analyse

Measure the molarity of the neat library and dilutions on a LabChip GXII Hisense kit (or equivalent fragment analyser) following the manufacturer's instructions:

Based on the average fragment length and Qubit measurement, calculate the molarity of the library dilutions. Create a standard curve to check that the concentrations are linear. If they can be "trusted", extrapolate the neat concentration based on the dilutions. Average all the measurements of the neat concentration to get the best estimate of the library molarity.
Dilute the library to between 2-4 nM in Ultrapure water.
Note
Note that if your libraries were built using the single-stranded protocol (Gansauge and Meyer 2013; Gansauge et al. 2017), you will need CL72_custom_sequencing_primer to sequence. This can be spiked into well 12 (but select 'no custom primer' in the run set up) or into well 18 (select 'custom primer' in the run set up). Spiking the custom primers into the run is preferable so that the remaining Illumina primers are present and can sequence PhiX.

You do not need custom i5_indexing_primer to sequence off a MiSeq or NovaSeq because these instruments prime off P5. You do not need a custom i7 indexing primer because it uses primers already included in the kit. Note that for the NextSeq you will need custom i5_indexing_primer in addition to the CL72_custom_sequencing_primer.

Follow the manufacturer's instructions to perform the sequencnig run on your Illumina platform of choice.
Use a Vivaspin 500 (MWCO 30,000 Da) centrifugal column to concentrate each library to 20-40 ul. Centrifuge at 15,000 rcf with the membrane facing outwards for 30 sec at a time.


Alternatively, concentrate the libraries using a SpeedyVac system, following the manufacturer's instructions.

Size select and purify

Run each pool in duplicate across two lanes (20 ul each) of a PippinHT electrophoresis system (2% gel, Marker 20B), selecting fragments between 160-500 bp and following the manufacturer's instructions:

Combine replicates. Purify the libraries using SeraMag Speed Beads or SeraMag Select using a 2X beads : reaction volume (i.e., 160 ul). Follow the guidelines below:


Elute in 25 ul of Ultrapure water.
Quantitate the final library
Dilute the libraries 1/2, 1/5, 1/10 in Ultrapure water (i.e., create a serial dilution in 10 ul volume).
Measure the concentration of the neat library and these dilutions in duplicate on the Qubit following the manufacturer's instructions.

Measure the molarity of the neat library and dilutions on a LabChip GXII Hisense kit (or equivalent fragment analyser) following the manufacturer's instructions:

Based on the average fragment length and Qubit measurement, calculate the molarity of the library dilutions. Create a standard curve to check that the concentrations are linear. If they can be "trusted", extrapolate the neat concentration based on the dilutions. Average all the measurements of the neat concentration to get the best estimate of the library molarity.
Sequencing
1h
Dilute the library to between 2-4 nM in Ultrapure water.


Follow the manufacturer's instructions to perform the sequencnig run on your platform of choice.