Feb 01, 2022
DNA extraction protocol for DNA-metabarcoding of marine phytoplankton using Zymobiomics DNA minprep kit (Zymo Research; D4300)
- Andersson Agneta1,
- Bengt Karlson2,
- Andersson F. Anders3,4,
- Sonia Brügel5,
- Latz Meike3,4,
- Lycken Jenny6,
- Mikael Hedblom6,
- Anders Torstensson6,
- Markus Lindh6
- 1Umea University;
- 2Swedish Meteorological and Hydrological Insitute;
- 3Science for Life Laboratory;
- 4Royal Institute of Technology;
- 5Umeå;
- 6Swedish Meteorological and Hydrological Institute
Protocol Citation: Andersson Agneta, Bengt Karlson, Andersson F. Anders, Sonia Brügel, Latz Meike, Lycken Jenny, Mikael Hedblom, Anders Torstensson, Markus Lindh 2022. DNA extraction protocol for DNA-metabarcoding of marine phytoplankton using Zymobiomics DNA minprep kit (Zymo Research; D4300). protocols.io https://dx.doi.org/10.17504/protocols.io.bucjnsun
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working
Created: April 20, 2021
Last Modified: February 01, 2022
Protocol Integer ID: 49259
Keywords: DNA, plankton, barcoding, 16S, 18S, extraction, biomass, biodiversity, phytoplankton, ocean, marine, Baltic Sea, Kattegatt, Skagerakk, Baltic, metabarcoding of marine phytoplankton, marine phytoplankton, identifying phytoplankton, biodiversity of phytoplankton, phytoplankton, basis of marine food web, using zymobiomics dna minprep kit, plankton species in environmental sample, throughput sequencing of taxonomic marker gene, zymobiomics dna minprep kit, marine food web, quantifying plankton species, zymobiomics dna miniprep kit, studying plankton diversity, taxonomic marker gene, dna extraction protocol, plankton ecology, taxonomic identification, plankton diversity, metabarcoding results with taxonomic identification, background dna in the water, dna extraction protocol for dna, dna extraction, complementary expertise in plankton ecology, part of the swedish national marine monitoring programme, marine monitoring, organism, harmful algae, swedish national marine monitoring programme, diversity of phytoplankon, qua,
Funders Acknowledgements:
Swedish Agency for Marine and Water Management and the Swedish Environmental Protection Agency
Grant ID: DNA-metabarcoding of marine phytoplankton
Abstract
The DNA extraction protocol described in this document follows the standard protocol provided with the Zymobiomics DNA miniprep kit (https://files.zymoresearch.com/protocols/_d4300t_d4300_d4304_zymobiomics_dna_miniprep_kit.pdf) with a few modifications. The protocol is part of the project "DNA-metabarcoding of marine phytoplankton" funded by the Swedish Environmental Protection Agency and the Swedish Agency for Marine and Water Management.
Phytoplankton play a key role in global biogeochemical cycles and form the basis of marine food webs. Quantitative assessment of the abundance and biodiversity of phytoplankton is therefore a natural component of environmental monitoring programs. Until now such monitoring has largely been based on microscopic counting. This is a time consuming process and requires personnel with high skill for identifying the organisms, and the smallest cells can hardly be identified with this method. There is hence an urge for faster, more precise and reproducible ways of quantifying plankton species in environmental samples. High-throughput sequencing of taxonomic marker genes (metabarcoding) has emerged as a popular alternative for studying plankton diversity. However, also this method has its limitations, and in order to be robustly implemented in monitoring programs, protocols need to be optimised and validated. The main goal of the project is to evaluate high-throughput sequencing as a tool to investigate the diversity of phytoplankon in the seas surrounding Sweden, with special focus on non-indigenous species and harmful algae. Specifically we want to test effects of storage of samples, sample volume, replication and background DNA in the water (“eDNA”), develop and evaluate an improved method for identifying phytoplankton based on sequencing a longer region of the rRNA operon and compare results from metabarcoding with results from microscope-based methods. The tests will be conducted on water samples collected as part of the Swedish National Marine Monitoring programme. This will provide a large data set covering all major sea areas surrounding Sweden and allow us to compare the metabarcoding results with taxonomic identifications obtained using microscopy as part of the monitoring programme. This collaborative project will be conducted by a team of researchers with complementary expertise in plankton ecology, marine monitoring, molecular biology and bioinformatics.
Image Attribution
Mikael Hedblom & Markus Lindh (C), SMHI
Materials
Before you start make sure that you have the following equipment (not supplied by the kit manufacturer) described in Table 1.
TABLE 1. Equipment required for DNA extraction with Zymobiomics DNA miniprep kit (Zymo; Cat# D4300).
| A | B | C | |
| Required equipment | Activity | Catalog number (if applicable) | |
| Sink | General wash | ||
| Fridge (+4°C) | Store chemicals and samples | ||
| Freezer (-20°C) | Storage of chemicals, short storage of filters etc. | ||
| 70% Ethanol | Sterilization of benches and equipment | ||
| Glass beakers | Disposing leftover liquids and pipette filter tips | ||
| Micropipettes in varying sizes (1000 µl, 200µl, 10µl) with pipette filter tips, e.g. Eppendorf Reference 2 | Extracting and quality check for DNA | 4924000916 | |
| Forceps | Handling filters | ||
| Petri dishes | Handling filters | ||
| Vortex with adapter, e.g. Vortex-Genie 2 and adapter Horizontal Microtube Holder | (1) Lyse cells. Shake tubes with filters and beads (tubes comes with the DNA extraction kit), (2) Mixing extracts solution during DNA extraction | SI-A256, SI-H524 | |
| Sterile Bench | Extract DNA for sensitive samples | ||
| Eppendorf centrifuge (1.5/2 ml rotor), capable of 16,000 x g, e.g. Sorvall Legend Micro 17 | Used during DNA extraction | 75002430 | |
| Rack for Eppendorf microcentrifuge tubes | Used during DNA extraction | ||
| Eppendorf microcentrifuge tubes 1.5 ml | Used to capture (1) eluted DNA and (2) purify eluted DNA | 0030108051 | |
| Qubit Fluorometer with dsDNA HS (high sensitivity) Assay Kit | Measure DNA concentration in extracts | Q33240, Q33231 |
Troubleshooting
Sample/Filter collection of biomass at sea
30m
Filter water samples onto 0.2 µm pore size Millipore filter (Merck Millipore; GSWP04700) attached to a filter funnel connected to a vacuum source. Filter a minimum of 500 ml collected seawater.
500 mL Seawater
Note
Filter up to 500 ml of seawater at a pressure less than 200mm Hg/267mbar/27kPa. Try to keep the filtration time below 60 minutes. Start the filtration as close to sampling as possible preferably within 60 minutes. If it is not possible to start filtration within 60 minutes then incubate the water sample at close to in situ temperature and take note of the incubation time.
30m
Using two sets of sterile forceps, pick up the filter membrane at opposite edges and roll the filter into a 2 ml cryo tube (Avantor, 479-1262) with the top side of the filter facing inward.
1m
Take note of station, date, sample ID, sampling time, time duration of filtration, filtered volume and any comments of potential use (such as filtration problems, colour of filter etc.).
1m
Store the filters at minimum -20°C (short-term storage) or -80°C (long-term storage) no additional reagent for preservation is needed.
-20 °C Freezer storage
Note
A preservation agent, DNA/RNA Shield™ (Zymo Research;R1103), can be used to simplify storage and downstream processing while increasing the possible storage time. In theory, filters stored in cryo tubes preserved with DNA/RNA Shield™ can be kept in room temperature for >1 year until processing. For more information see separate protocol here https://files.zymoresearch.com/protocols/_r1100-50_r1100-250_r1200-25_r1100-125_dna_rna_shield.pdf.
Laboratory preparations
20m
- Clean your work bench with 70% ethanol.
- Prepare sterilized forceps and petri dish on the bench.
- Prepare pipettes in varying sizes with filter tips.
- Take out beakers for discarding liquids and used tips.
- Turn on the microcentrifuge and set the machine to 13000 x g for 1 minute.
- Prepare Vortex with adapter plates and set timer for 10 minutes.
10m
Prepare spike-in genes using artificial 16S and 18S rRNA gene oligonucelotides (designed in-house and generated by Twist Bioscience). See sequences and sub-steps below:
Note
>16SrRNA_gene_1447bp_ATGCfreq_E.coli NR_024570.1_primerbindingsites_341F_515F_805R_806R
GGGGTGAACGTCCGGCGTGGGGTCACCTAGTAAGAGAGAGCGGCCGGGACATCAATAGACCGGCTGAGTGTTGGGATAGGTAGGTCGCGATTGTGTTAAGTTTTGGCCGCCGTGCTTGAAGAAAGTCCCGGGGACAGGAGGAACCGACGGTGAGCGGTGGAGATGGCAACGCGGAGCGCCCATGAAGGAGCCAGGACTGACTGGCTTGGGACGAGTAATCTACGTGATTTTACAGAACCCTCGTGGGCGCTAGAGAGGAGCATCCCGTGTCTGCGGCGCATCAGCAGTGAACGGTGTCACTGACCAGCATCACTGGCGTATGGCGCGGGGTCCTACGGGAGGCAGCAGACGGGCAGCTCTCGATAACCGGCGGAAGGTGGTAGCCACGGACAGGATCAGAACAATTAGAAGTGCCGCAGGTGGCCAAGTCCCCCGGACACAAGACGAGGCCGGAGGCCTGGTATATACACGTAGCTAAGAAGAGCTCATCCAGACTGGGAACGGTGTGCCAGCAGCCGCGGTAACATCACCACAACGTATTCGGTCACAAATTGATCGGAGGGAGAAATCGTCCGCAGGATCTCAAACTTTAACTAAGGACTAGTACTACATAGGCTCGAGAAGAGCTACCGTTTGCAGGGTCGCCGGGTACCGCTTAACCATAAAAGATCCACTCAGGTAGCCGTCCAGTTTCCTCTGAAATGATGGGGCGAGAAACACGGCTGGGCGTTATACGAGTGCTTTAGAATATGAGGAGAGACAGGGGTATATTCAAGGATTAGATACCCTGGTAGTCCCGATCTCGATCTACGTCTGGACGTGACGTGTACATTCTGGTCGAAACGGTACAAAGATCGTTTGGAGATGGAGGGGCGCGCATAAACATGAGTCAGCGCACCTACTACACTGCATTGACGACGAGTCAAGCGGGTTGGAACCGACCCAGGACCGTGTGCTCTGGGACATGCCTAGACAGGAAGGTGACGTATAGGAGACGTCGAGGGGGAGATATAGCCGTGGGTCAAAGCTAATCGTACCCCGCCTTCCGCTAGCTCATAATTTGCTTCCTGGGACCAAGCCGCTGAGGGATTACGGTATCTAGTTGCTCGGCGACTTTGGGAATAGCCACACTGATCGAGGTGAGAGGAAGGGAAGTATGTAAAGTTTGTCTTAGGGTACCGGCAGGTGGCGCAATCTTCTCCTTGCGAAGGAAGGGGGGACCGAGCATGGGTCAGAATGACTCCGGGGCGTAGGGTACACAAGGGTGCAGCGACCAGGGCCGCGCGAATTGTTGAATGCTATGTATTATATCGAGTGTGCGTTGGCAGCGAACGCTAAGACGTGTCGGAGCCTGCAGCTGTGAAGTTTAACCGTGACACCTATACAATGTTCAGAATGGGGGGTTAGTTATAGATGGTAGCCCGTTTGCAACGGTTCCTCGCGAATC
Note
>18SrRNA_gene__ length1261_primersites_563f/V4fw-1563(18)_TAReuk454FWD-1564(20)_TAReukREV3-1991(18)_V4rev-2017(18)_1132r-2157(18)_V9dropfw_2205(22)_V9fw-2207(18)_V9droprev-2675(19)_V9rev-2676(18)
AAGAGAGCCATGGCGTGAAGTAGCGGGATGAGTTACCCTCCATACTAGTAAATACGGCGTGTTTTCAAATGCCCCTGCCAACCTACATAGATGGGACTAAGCCAGCAGCCGCGGTAATTCCCTTCGTTATCGTCACGGAGAGAACTGCCTTTAGCGATCTGTCTAGAGACCCGCCAAATATAAGCCTTGGGGTTATTAACAAAGACGCCAAACACTAGTGAATATGACAGTGAAGGGGTGTGAGATAGCTTTACTGGGTGAGAAAACACTCGTTAAAAAGAATTAGACCGGATAATCCCCGAGGGGCCGTAGGCATGGACTTGTCGTTGCCACCGAGCATAGCGGTTTCGAAATAGCCGAGATGGGCACTGGCGAATTAACCCACTGGTTTATATGGATCCGATGGGTTCACTTAATAAGCTCGTACCAGGGATGAATAAAGCGTTACGAGAATTATAAACATGGAGTTCCTATTGATTTGAGGTTAATACCGAACGGGAACATTTGTCGATCATGCTTCACATAGAGTTTAATCAAGAACGAAAGTACAGTCTTCGAAGTGGATTAGATACCGCCGACCTAGTGACGCGAATATATCGATGACGATCTCCTATAACGGGAGGTCTCGTTAACTGACTGTGTATGGTTGTCCGTGTTTCGAATTAGGAGAAGGTTAAAGACTGTGATCGTGATAAATTTAAAGGAATTGACGGGCTTTGATTAGTAGTTCCCGTTACCTCAATTCAATTCGAATCAACGCGGGGAAAGTCGCCGGCCAATATCAGCTTTTATTGATTAGTGGGGTATTAGATTGGCAGACTGAATAGCCAACAGAGTGCAGTTATTTCCGTTACTTGATACTCGCTGCGACTTACCGGGGCTTGGTAAGTGCACCATAACAGTGCACGTTTGCTCATCTACATATCAAAGTTTTGGTCTTTTGTCTGCTGGCTGATGCTGTAAAGCTCGTACGACGGGCCCAGTCTACAGAACGGCTTTGTCTAAGTACTGAGGCAGGGAGCATGACTTGCCGAAGTGATGTAGAGTGGAATGTCGCCATCCGTGACAGTATAATGGGGCGAGGAGAGGACTTCGCTGGGTATCTTAGTCACAGAAGAATGGCTCGGTTTTTACTTGATGATTTGGCCAGTATGAAACGCTCACGCCCTGTTTAGATTCTTGGAGCGCAGTATGTTAATCTAGTCCACATCCTTTTGTACACACCGCCCGTCGTTCTTCATTGGTGTTTGGTGGGTAGTGTAA
Note
The sequences are random but based on the GC content of a consensus 18S of the PR2 sequences and 16S on the E.coli sequence. Both contain primer positions for several primer pairs (specified in the fasta header) that produce amplicons with a length to be expected from real samples. If needed it is easy to add other primer motifs.The oligonucleotides are delivered as a dry pellet with a concentration of 1000 ng. The goal concentration of spike-in genes is to reach around 5% of total 16S and 18S rRNA gene sequences in the final extracted sample of genomic DNA. Using results from metagenomic data across a whole season (both low and high biomass) the calculated amount of 16S and 18S rRNA gene material to be added to samples, regardless of season or biomass collected, is presented in Table 2.
TABLE 2. Calculated amount of spike-in 16S and 18S rRNA gene oligonucleotides, based on metagenomic data, to add in order to reach approximately 5% concentration in a given sample of extracted genomic DNA.
| A | B | C | |
| Spike-in gene concentration | 16S spike DNA to add (ng) | 18S spike DNA to add (ng) | |
| 5 % | 0.00204 | 0.00729 |
Add 100 µl sterile filtered autoclaved MQ, DNase/RNase Free Water or TE buffer to the dry pellet bringing the stock solution to a concentration of 10 ng/µl.
100 µL MQ
Then, in sequence through continued serial dilution in steps of x 10 dilutions, prepare working solutions with the final concentration of the 16S and 18S spike-in DNA to 0.0002 ng/µl and 0.0007 ng/µl, respectively, note the x 10 dilution for the final concentration compared to Table 2.
Aliquot and freeze working solution in batches at -20°C until processing.
-20 °C Freezer storage
Laboratory procedure
13m
Thaw filters in the sampling tubes at room temperature and add the filter cut into small pieces to a ZR BashingBead™ Lysis Tube (0.1 & 0.5 mm).
Room temperature Filter thaw
Note
What’s happening? Cutting the filter membrane into the ZR BashingBead™ Lysis Tube allows for efficient bead beating and homogenization in proceeding steps.
5m
Rinse the sampling tube with 750 µl and add the Lysis Solution into the ZR BashingBead™ Lysis Tube.
750 µL ZymoBIOMICS Lysis Solution
Note: For samples stored and lysed in DNA/RNA Shield™ Lysis buffer, do not add ZymoBIOMICS™ Lysis Solution and proceed to step 9.
1m
Add 10 µl of the prepared dilutions of 16S and 18S spikes, and cap tightly.
10 µL 16S and 18S spikes
30s
Secure in a Vortex-Genie 2 fitted with a 2 ml tube holder assembly (adapter) and process at maximum speed for 10 minutes.
3200 rpm, Room temperature , 00:10:00
Note: Vortex for 10 min at maximum speed (2850Hz) on a Vortex-Genie 2 is a specific selected step and slight modification from the standard ZymoBIOMICS protocol.
Note
What’s happening? The mechanical action of bead beating will break apart the surface of the filter membrane that contains trapped cells and aids in cell lysis. Use of the vortex adapter will maximize homogenization by holding the tubes equal distance and angle from the center of rotation.
10m
Centrifuge the ZR BashingBead™ Lysis Tubes (0.1 & 0.5 mm) in a microcentrifuge at 13,000 x g for 1 minute.
13000 x g, Room temperature, 00:01:00
Note
What’s happening? The supernatant is separated and removed from the filter membrane and beads at this step.
1m
Transfer up to 400 µl supernatant to the Zymo-Spin™ III-F Filter (red mark) in a Collection Tube and centrifuge at 8,000 x g for 1 minute. Discard the Zymo-Spin™ III-F Filter.
400 µL supernatant
8000 x g, Room temperature, 00:01:00
Note
What’s happening? Any remaining beads, proteins, and cell debris are removed at this step. This step is important for removal of any remaining contaminating non-DNA organic and inorganic matter that may reduce the DNA purity and inhibit downstream DNA applications.
1m
Binding preparation: Add 1,200 µl of ZymoBIOMICS™ DNA Binding Buffer to the filtrate in the Collection Tube from Step 12. Mix well.
1200 µL ZymoBIOMICS™ DNA Binding Buffer
1m
Transfer 800 µl of the mixture from Step 13 to a Zymo-Spin™ IICR Column in a Collection Tube and centrifuge at 10,000 x g for 1 minute.
10000 x g, Room temperature, 00:01:00
Note
What’s happening? The DNA is selectively bound to the silica membrane in the Spin Filter basket and the flow through containing non-DNA components is discarded.
1m
Discard the flow through from the Collection Tube and REPEAT STEP 14.
2m
Place the Zymo-Spin™ IICR Column in a NEW Collection Tube.
30s
Add 400 µl ZymoBIOMICS™ DNA Wash Buffer 1 to the Zymo-Spin™ IICR Column and centrifuge at 10,000 x g for 1 minute. Discard the flow-through.
400 µL ZymoBIOMICS™ DNA Wash Buffer 1
10000 x g, Room temperature, 00:01:00
Note
What’s happening? ZymoBIOMICS™ DNA Wash Buffer is an alcohol based wash solution used to further clean the DNA that is bound to the silica filter membrane in the Spin Filter. This wash solution removes residual salt and other contaminants while allowing the DNA to stay bound to the silica membrane.
1m
Add 700 µl ZymoBIOMICS™ DNA Wash Buffer 2 to the Zymo-Spin™ IICR Column in a Collection Tube and centrifuge at 10,000 x g for 1 minute. Discard the flow-through.
700 µL ZymoBIOMICS™ DNA Wash Buffer 2
10000 x g, Room temperature, 00:01:00
Note
What’s happening? ZymoBIOMICS™ DNA Wash Buffer 2 ensures complete removal of ZymoBIOMICS™ DNA Binding Buffer and ZymoBIOMICS™ DNA Wash Buffer 1 which will result in higher DNA purity and yield.
1m
Add 200 µl ZymoBIOMICS™ DNA Wash Buffer 2 to the Zymo-Spin™ IICR Column in a Collection Tube and centrifuge at 10,000 x g for 1 minute.
200 µL ZymoBIOMICS™ DNA Wash Buffer 2
10000 x g, Room temperature, 00:01:00
Note
What’s happening? The second spin removes residual ZymoBIOMICS™ DNA Wash Buffer 2. It is critical to remove all traces of wash solution because the ethanol can interfere with many downstream DNA applications such as PCR, restriction digests, and gel electrophoresis.
1m
Transfer the Zymo-Spin™ IICR Column to a clean 1.5 ml microcentrifuge tube and add 50 µl ZymoBIOMICS™ DNase/RNase Free Water directly to the center of the column matrix and incubate in room temperature for 1 minute. Centrifuge at 10,000 x g for 1 minute to elute the DNA.
50 µL ZymoBIOMICS™ DNase/RNase Free Water
Room temperature 1m
10000 x g, Room temperature, 00:01:00
Note: Adding 50 μl of ZymoBIOMICS DNase/RNase Free Water is a specific selected step and slight modification from the standard ZymoBIOMICS protocol.
Note
What’s happening? Placing ZymoBIOMICS™ DNase/RNase Free Water (sterile elution buffer) in the center of the small white membrane will make sure the entire membrane is wetted. This will result in a more efficient and complete release of the DNA from the silica Spin Filter membrane. As ZymoBIOMICS™ DNase/RNase Free Water passes through the silica membrane, the DNA that was bound in the presence of high salt is selectively released by ZymoBIOMICS™ DNase/RNase Free Water which lacks salt. ZymoBIOMICS™ DNase/RNase Free Water contains no EDTA. If DNA degradation is a concern, sterile TE may also be used instead of ZymoBIOMICS™ DNase/RNase Free Water for elution of DNA from the Spin Filter.
1m
Place a Zymo-Spin™ III-HRC Filter in a NEW Collection Tube and add 600 µl ZymoBIOMICS™ HRC Prep Solution. Centrifuge at 8,000 x g for 3 minutes.
600 µL ZymoBIOMICS™ HRC Prep Solution
8000 x g, Room temperature, 00:03:00
3m
Place the prepared Zymo-Spin™ III-HRC Filter in a clean 1.5 ml microcentrifuge tube. Make sure to mark the tube (both lid and side) clearly with a unique ID using a permanent marker resistant to freezing.
30s
Transfer the eluted DNA (Step 20) to the Zymo-Spin™ III-HRC Filter and centrifuge at exactly 16,000 x g for 3 minutes.
16000 x g, Room temperature, 00:03:00
Note
What’s happening? TheZymoBIOMICS™ HRC Prep Solution includes PCR Inhibitor Removal technology enabling PCR from the most PCR prohibitive environmental samples rich in humic and fulvic acids, tannins, melanin, and other polyphenolic compounds.
3m
Freeze extracted gDNA at -20°C or -80°C. Measure the concentration of the extracted DNA using Qubit Fluorometer; see separate protocol for Qubit provided by the manufacturer. The filtered DNA is now suitable for PCR and other downstream applications.
-20 °C Freezer storage
30m