Apr 16, 2025

DNA extraction and qPCR protocol for sensitive detection of Trypanosoma cruzi in blood

  • 1University of Georgia
Icon indicating open access to content
QR code linking to this content
Protocol CitationBrooke E. White, Rick Tarleton 2025. DNA extraction and qPCR protocol for sensitive detection of Trypanosoma cruzi in blood. protocols.io https://dx.doi.org/10.17504/protocols.io.ewov1dm87vr2/v1
Manuscript citation:

White Brooke E, Hodo Carolyn L, Hamer Sarah A, Saunders Ashley B, Laucella Susana A, Hall Daniel B, Tarleton Rick L (2025) Serial ‘deep-sampling’ PCR of fragmented DNA reveals the wide range of Trypanosoma cruzi burden among chronically infected hosts and allows accurate monitoring of parasite load following treatment eLife 14:RP104547

License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 30, 2025
Last Modified: April 16, 2025
Protocol  Integer ID: 119293
Keywords: Trypanosoma cruzi, PCR, Chagas disease, deep-sampling, qPCR, DNA extraction, fragmentation, trypanosoma cruzi in blood, presence of trypanosoma cruzi, dna extraction, trypanosoma cruzi, qpcr protocol for sensitive detection, dna sample, chagas disease, qpcr protocol, dna fragmentation, dna, well capacity qpcr instrument, sensitive detection, large 384 well capacity qpcr instrument
Funders Acknowledgements:
National Institutes of Health
Grant ID: R03 AI166504
Abstract
This protocol summarizes all steps for "deep-sampling" DNA samples extracted from blood that is screened for presence of Trypanosoma cruzi. Through a combination of careful handling, large 384 well capacity qPCR instruments, and DNA fragmentation, this protocol allows highly sensitive detection of the agent that causes Chagas disease.
Guidelines
Contamination Precautions: All steps should be performed in dedicated Biosafety Cabinet. All equipment should be reserved for this use only and not shared between other projects or areas of the lab. Spray work surface with 70% ethanol and apply UV light to cabinet at least 15 minutes before beginning work.
Use LookOut DNA Erase spray to supplement cleaning cabinet surface.
Using multichannel pipettes is an essential part of contamination control for our protocol. When 384 well plates are used, pipetting 96 wells at one time is preferred (we like the Integra mini 96).
All components (primers, probes, itaq mix) for qPCR master mix should be aliquoted into single use tubes when possible to avoid repeated opening of the same tube. This also prevents multiple freeze/thaw cycles for qPCR components.
When working with large amounts of T. cruzi DNA - such as when preparing amplification standards- prepare and process these separately from normal samples. Processing samples with very high amounts of T. cruzi DNA (higher than would normally be encountered in host blood) poses a high risk for contamination of other samples, even when taking all precautions outlined here. Do not extract DNA from high parasite standard samples at the same time as blood samples being tested for parasite DNA.
Materials

Kits:
Omega Biotek E.Z.N.A. Blood DNA Maxi Kit (item # D2492-03)
Chemicals and reagents:
PBS (Gibco 10010023)
100 % ethanol
LookOut DNA Erase spray
BioRad iTaq Universal Probes Supermix
Nuclease free water (Ambion AM9937)
Primers
Taqman probes
IAC (g-block from IDT)
Consumables and other material:
50 mL conical tubes
1.5 mL snap cap tubes
0.5 mL snap cap tubes 96-Well Polypropylene PCR Plates, Low Profile, Thin Wall, Skirted, White/Clear or Hard-Shell 384-Well PCR Plates, thin wall, skirted, clear/white #HSP3805
Pipette basins
Microseal 'B' PCR Plate Sealing Film, adhesive, optical #MSB1001
Equipment:
Nanodrop
vortex mixer
pipettes and appropriate filter tips
Biosafety cabinet (UV sterilization)
swing bucket centrifuge with capacity for 15ml and 50ml conical tubes
qPCR software Bio-Rad CFX Manager Software (version 3.1)
Shake-N-Bake instrument set to 70°C (other incubator equipment can also work here: it just needs to be able to reach 70°C and have a moveable platform to mix samples during incubation)
C1000 Touch Bio-Rad CFX96 real-time PCR detection system or CFX Opus 384 Real-Time PCR System (#12011452)
Bio-rad mini chiller with variable speed pump (170-3654)
Branson SFX250 Sonifier with support stand and converter clamp
3 inch Cuphorn attachment
Integra Mini 96 pipettor
Before start
Setting up a dedicated work space inside a Type II Biosafety Cabinet away from common pathogen DNA producing parts of the lab is key. Using this dedicated clean space and following the contamination prevention guidelines described in this protocol have enabled us to extract hundreds of DNA samples and run thousands of pcr reactions while avoiding cross contamination.
Note: See "Guidelines" section of this protocol for more details on contamination prevention.

  1. Pre-heat Shake-N-Bake (or similar incubator) to 70°C.
  2. Place 50 mL conical tube of elution buffer in incubator.
  3. Turn on cuphorn chiller to pre-chill at 4°C.
  4. Prepare all reagents for DNA extraction. Add isopropanol and ethanol to respective buffers as directed in E.Z.N.A. maxi kit.
DNA extraction
2h 3m
Take 3-10 mL blood freshly collected in K2EDTA (purple top) blood collection tubes preserved on ice and centrifuge at 2000 g for 15 minutes to separate plasma from blood cells.
Note: If blood is previously separated and frozen, thaw completely before starting extraction.
15m
Transfer plasma layer to storage tube(s) with pre-printed labels detailing sample information and date and store at -80 for use as needed.
15m
DNA Extraction Part 1 (Lysis)
Transfer the cell pellet from blood into a nuclease-free 50 mL conical tube and bring the volume up to 10mL with PBS
Note: You can use plasma, whole blood, or the cell pellet here but we have found the cell pellet to be the most sensitive.
Add 250 μL Proteinase K solution (included with kit)
Vortex to mix well.
Note: Tubes should be tightly closed before vortexing.
Add 10.2 mL BL Buffer (included with kit).
Add 20 μL RNase A (Included with kit).
Vortex to mix thoroughly.
Incubate at 70 °C in Shake-N-Bake incubator for 30 minutes, vortexing the tube once at the halfway point.
Note: Shaker platform should be on medium rocking speed during incubation.

30m
DNA Extraction Part 2 (DNA isolation)
Add 10.3 mL 100% ethanol to the lysed blood mixture and vortex to mix.
Insert a column into a 50mL collection tube, both from the kit.
Transfer the lysed sample to the column, including any precipitates.
Centrifuge column and tube at 4,000 rcf for 5 minutes.
5m
Repeat Steps 4.3 + 4.4 until entire sample is transferred. Each transfer will be approximately 15 mL.
5m
Discard the filtrate in the tube, retaining the collection tube.
Add 5 mL HBC Buffer (included with kit) to the column.
Note: HBC Buffer must be diluted w/ isopropanol before use.
Centrifuge at 4,000 rcf for 3 minutes.
3m
Discard the filtrate and retain the collection tube.
Add 15 mL DNA Wash Buffer (included with kit) to the column.
Note: Wash Buffer must be diluted w/ethanol before use.
Centrifuge at 4,000 rcf for 5 minutes.
5m
Discard filtrate and reuse the collection tube.
Add 15 mL DNA Wash Buffer for a second wash step.
Centrifuge at 4,000 rcf for 5 minutes.
5m
Discard filtrate and reuse the collection tube.
Centrifuge the empty column at 4,000 rcf for 10 minutes to dry the column.
Note: This is critical to remove any trace ethanol that could interfere with downstream applications.
10m
Transfer the column into a new nuclease-free 50 mL tube
Note: Conical tube not provided with kit
Dry the column further at 70 °C for 10 minutes inside the Shake-N-Bake incubator.

10m
Wipe down the inside of the centrifuge with bleach followed by water to prevent corrosion.
Buckets and bucket inserts should also be washed thoroughly during this time.
Note: This step is important for contamination prevention.

Add 500 μL HOT (70°C) Elution Buffer (included with kit) directly to the filter inside the column.
Let sit at room temperature for 3-5 minutes.
5m
Centrifuge at 4,000 rcf for 5 minutes.
5m
Transfer eluted volume back onto the filter inside the column and add 150 μL fresh Elution Buffer.
Let sit at room temperature for 3-5 minutes.
5m
Centrifuge at 4,000 rcf for 5 minutes.
5m
Transfer eluted material into nuclease-free 1.5 mL microcentrifuge tube.
Measure DNA quantity.
Store eluted DNA at -20°C (or 4°C if planning PCR soon).
DNA Fragmentation with Cuphorn Sonication
30m
Wrap 1.5 mL microcentrifuge tubes containing extracted DNA in parafilm

Place samples in floating foam rack
Place in chilled cuphorn
Set sonifier to continuous mode with a time interval of 50 seconds and 60% amplitude
Start sonifier and repeat sonication 5 times for a total of 5 cycles of 50 seconds with 60% amplitude
Place samples back on ice and continue preparations for qPCR
qPCR SETUP
3h
After fragmenting, dilute DNA to desired concentration (200 ng/µl) in ultrapure water. Preferably in 96 well plates to make transfer to qpcr plate easier.
30m

Recipe for master mix for each pcr plate

ABC
ComponentVolume per 20µl reactionVolume per 96 well plate (106 reactions)
premix itaq univeral probe mix101060
Cruzi 1 primer (10 µM)1.5159
Cruzi 2 primer (10 µM)1.5159
IAC primer FW (10 µM)0.221.2
IAC primer Rev (10 µM)0.221.2
Cruzi 3 probe0.110.6
IAC probe0.110.6
Water0.442.4

20m
Add 14 µl mastermix + 1 µl IAC (25 pg/ µl) + 5 µl diluted sample DNA to each well
10m
Include no template controls (NTC) and a sample with known T.cruzi DNA concentration in each plate.
Note: For our typical assay, we run samples in 384 well plates and include 16 NTC reactions in each plate.
Spin down briefly before beginning cycler program.
Follow cycling conditions listed below. Be sure to select "all channels" when running protocol
2h



AB
PCR temperaturetime
953 min
9515 sec
581 min
repeat steps 2 and 3 x50
conditions for Bio Rad Opus 384

Export program file at the end of protocol and analyze using CFX Manager software
Supplementary Information

AB
Componentsequence
Cruzi 1ASTCGGCTGATCGTTTTCGA
Cruzi 2AATTCCTCCAAGCAGCGGATA
IAC F ACCGTCATGGAACAGCACGTA
IAC R CTCCCGCAACAAACCCTATAAAT
Cruzi3 probe 5'-Fam-CACACACTGGACACCAA-NFQ-MGB-3'
IAC probe 5’ -VIC-AGCATCTGTTCTTGAAGGT-NFQ-MGB-3’
Primer and probe details




AB
IAC (Internal Amplification control) (g-block from IDT) TGTTCTTAAAGTAACCGTCATGGAACAGCACGTACCGATTTATAAGATTGCTGGAGAAATGACTGGATTTGGAGCATCTGTTCTTGAAGGTGTTTTAGCTTTCGTCTTGGTTTATACTGTGTTCACGGCTAGCGATCCCAGACGTGGGCTACCTTTAGCAGTGGGACCTATATTTATAGGGTTTGTTGCGGGAGCCAATGTTCTAGCCGC
IAC details

Protocol references

* Cruzi 1/2/3 primers/probe are from Duffy et al 2009, 2013 PLoS NTD, as originally from Piron et al 2007 Acta Trop; IAC primers/probe are from Duffy et al 2009, 2013 PLoS NTD