Mar 20, 2024

DNA Barcoding Protocol for Arthropods

This protocol is a draft, published without a DOI.
  • Valerie Warhol1
  • 1Science Club
Icon indicating open access to content
QR code linking to this content
Protocol CitationValerie Warhol 2024. DNA Barcoding Protocol for Arthropods. protocols.io https://dx.doi.org/
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 19, 2024
Last Modified: March 20, 2024
Protocol  Integer ID: 96938
Keywords: dna barcoding protocol for arthropod, dna barcoding protocol, dna barcode, amplification of dna barcode, arthropod, dna, basic protocol, barcoding, cois, extraction, doing extraction, small insect, protocol
Abstract
This is a basic protocol for doing extraction and amplification of DNA barcodes (COI) for arthropods (typically small insects or spiders).
Protocol materials
Guanidine Hydrochloride 6MCarolina Biological SupplyCatalog #C33427
Prepare sample and equipment
Make sure all instruments, such as forceps and pestle, are clean and sterile.

Prepare water bath at 65 °C .
Dissect sample from specimen (typically 1 leg). Return specimen to freezer.
Let sample dry for 5–10 minutes to remove ethanol.
Prepare a clean 1.5 mL hinged tube by writing sample ID on it and filling with 250 µL of Guanidine Hydrochloride 6MCarolina Biological SupplyCatalog #C33427

Lyse cells
11m
Put sample in tube. Grind sample with pestle until broken up into tiny pieces.
Incubate sample tube in 65 °C water bath for 00:10:00 .

10m
Remove tube and lower temperature of water bath to 57 °C .

Centrifuge tube for 00:01:00 at maximum speed to pellet debris.

1m
Remove Silica ResinCarolina Biological SupplyCatalog #C33426 from refrigerator.

Label a clean 1.5 µL tube with sample number. Transfer 150 µL of the supernatant to the clean tube. Discard old tube containing debris.

Bind DNA
5m 30s
Add 3 µL of silica resin to tube. Mix well by pipetting up and down several times.

Close tube and incubate for 00:05:00 in 57 °C water bath.

5m
Centrifuge for 00:00:30 at maximum speed to pellet the resin.

30s
Use a pipette with a fresh tip to remove the supernatant, being careful not to disrupt the pellet.
Wash
1m
Remove molecular grade water from refrigerator and Wash BufferCarolina Biological SupplyCatalog #C33428 from freezer.

Add 500 µL of ice-cold wash buffer to the pellet. Mix well by pipetting up and down several times to resuspend the silica resin.

Close the tube and centrifuge for 00:00:30 at maximum speed to pellet the resin.

30s
Use a pipette with a fresh tip to remove the supernatant, being careful not to disrupt the pellet.
Again, add 500 µL of ice-cold wash buffer to the pellet. Mix well by pipetting up and down to resuspend the silica resin.

Close the tube and centrifuge for 00:00:30 at maximum speed to pellet the resin.

30s
Return wash buffer to freezer.
Use a pipette with a fresh tip to remove the supernatant, being careful not to disrupt the pellet. Spin the tube briefly to collect any remaining drops of supernatant, and then remove these with a pipette.
Elute DNA
30s
Add 100 µL of molecule grade water to the silica resin and mix by pipetting up and down several times.

Incubate the mixture at 57 °C for 5 minutes.

Centrifuge for 00:00:30 at maximum speed to pellet the resin.

30s
Label a clean 1.5 µL tube with sample number. Transfer 90 µL of the supernatant to the clean tube, being careful not to disturb the pellet. Discard old tube containing the resin.

Store sample in freezer until ready to PCR. If going directly to PCR, put sample in refrigerator.
Amplify COI (PCR)
10m
For each DNA sample, label a PCR microtube with sample ID.
Turn on PCR thermal cycler and connect to computer.
Remove molecular grade water from refrigerator. Remove template DNA, PCR master mix, and primers from freezer. Let thaw for 00:10:00 .

ABCD
Primer NameDirectionSequenceConcentration
LCO1490 ForwardGGTCAACAAATCATAAAGATATTGG10 µM
HCO2198ReverseTAAACTTCAGGGTGACCAAAAAATCA10 µM


10m
Add 32 µL molecular grade water to each microtube.

Mix forward primer by flicking. Add 1.5 µL forward primer to each microtube.

Mix reverse primer by flicking. Add 1.5 µL reverse primer to each microtube.

Mix template DNA by flicking. Add 5 µL template DNA to each microtube.

Mix EZ PCR Master Mix 5XminiPCR by inverting. Add 10 µL PCR master mix to each microtube.

Put microtubes in PCR thermal cycler and start touchdown PCR.
  1. Denature: 95° C 30 sec; Anneal: 60° C 30 sec; Extend: 72° C 45 sec.
  2. Denature: 95° C 30 sec; Anneal: 59° C 30 sec; Extend: 72° C 45 sec.
  3. Denature: 95° C 30 sec; Anneal: 58° C 30 sec; Extend: 72° C 45 sec.
  4. Denature: 95° C 30 sec; Anneal: 57° C 30 sec; Extend: 72° C 45 sec.
  5. Denature: 95° C 30 sec; Anneal: 56° C 30 sec; Extend: 72° C 45 sec.
  6. Denature: 95° C 30 sec; Anneal: 54° C 30 sec; Extend: 72° C 45 sec.
  7. Denature: 95° C 30 sec; Anneal: 53° C 30 sec; Extend: 72° C 45 sec.
  8. Denature: 95° C 30 sec; Anneal: 52° C 30 sec; Extend: 72° C 45 sec. Repeat this step for 28 cycles.
  9. Final extension: 72° C 5 min.
(An initial long denature step is not needed for this protocol.)

Remove microtubes from PCR thermal cycler. Verify PCR using gel electrophoresis.
Store PCR products in freezer (-20 °C ).