Oct 20, 2025

Public workspaceDNA Barcoding of Fish Eggs Methods

  • Mya Breitbart1,
  • Makenzie Kerr1
  • 1University of South Florida College of Marine Science
Icon indicating open access to content
QR code linking to this content
Protocol CitationMya Breitbart, Makenzie Kerr 2025. DNA Barcoding of Fish Eggs Methods. protocols.io https://dx.doi.org/10.17504/protocols.io.3byl4wmbjvo5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 06, 2025
Last Modified: October 20, 2025
Protocol Integer ID: 123941
Keywords: DNA barcoding, Fish eggs, barcoding, ichthyoplankton, DNA, dna barcoding of fish eggs method, fish egg dna sample, dna from the fish egg, dna barcoding, fish eggs method, fish eggs down the the species level, fish egg, good quality dna, dna, fish, years with good quality dna, destructive sampling method
Funders Acknowledgements:
Florida Institute of Oceanography's RESTORE Act Centers of Excellence Program
Grant ID: USF Projects 4710112601 and 4710112901
Abstract
This DNA barcoding of fish eggs method is used to identify fish eggs down the the species level. Our lab has been using this method for about 10 years with good results and many publications. It is a destructive sampling method, meaning you will only have one chance to extract the DNA from the fish eggs. Once extracted, fish egg DNA samples have lasted in our -20 degree C freezers for over 5 years with good quality DNA. Many of the reagents used can be swapped for your preference.
Protocol materials
ReagentEthanol (100%, Molecular Biology Grade)Fisher ScientificCatalog #BP2818500
ReagentWater DNA Grade DNASE Protease freeFisher ScientificCatalog #BP24701
Reagent10 M NaOHMerck MilliporeSigma (Sigma-Aldrich)Catalog #72068
Reagent0.5 M disodium EDTAMerck MilliporeSigma (Sigma-Aldrich)Catalog #4055
Reagent1 M Tris-HClFisher ScientificCatalog #BP2473-1
ReagentAgarose powderApexBio TechnologyCatalog #20-101
ReagentEthidium Bromide (1% Solution/Molecular Biology)Fisher ScientificCatalog #BP130210
ReagentFlat PCR Caps, strips of 12Fisher ScientificCatalog #AB0851
ReagentAlumaSeal II Sealing FilmsFisher ScientificCatalog #AF100
ReagentBSA 20 mg/mLFisher ScientificCatalog #FERB14
ReagentDntpsGenesee ScientificCatalog #42-403
ReagentRed Taq & Buffers (NH4, MgCl2)Genesee ScientificCatalog #42-401R
ReagentGeneRuler DNA LadderFisher ScientificCatalog #SM0334
Troubleshooting
Picking Eggs
Prepare X amount of 1.5 mL screw cap tubes (1 per site)  
Equipment
Screw cap tubes and caps
NAME
Tube
TYPE
Genesee
BRAND
21-262, 21-266A
SKU

Label each tube with site # 
Pipette about 1 ml 70% ethanol into each tube 
-Make 70% ethanol in a falcon tube (7 parts ethanol to 3 parts DI water) ReagentEthanol (100%, Molecular Biology Grade)Fisher ScientificCatalog #BP2818500

You will be using a dissecting scope with dark field illumination, turn on the light 
Pour all contents of one vial of CUFES plankton into a square, gridded petri dish 
-Use disposable pipette to rinse out eggs stuck in vial with excess ethanol in plate 
-Don’t worry about getting all the plankton out, just the eggs 
Equipment
Square petri dish
NAME
Petri dish
TYPE
Andwin Scientific
BRAND
70691CS
SKU

Using the petri dish grid, go from left to right, up and down searching for eggs (see figure)
-This is to prevent bias of picking large or small eggs 
-Go through whole plate or until you have reached 100 eggs 
-Count the remaining eggs in the sample and record the number 
Petri dish diagram

Pick up eggs up using forceps (PL-30 size) and place into screw cap tube 
-Be careful to not pick up other plankton or pop eggs 
-Push each egg into the ethanol so they do not desiccate 
Use a counter clicker to keep track of how many eggs you have collected 
When you have finished the grid or collected 100 eggs, place a clean petri dish under the vial (to catch spills) 
Carefully pour the CUFES contents from the picking petri dish into the original vial 
-Use a disposable pipette and excess ethanol in vial to rinse off dish to gather all plankton back into vial 
-Use additional 70% ethanol to rinse off dish if needed 
-Do not overflow vial 
-If any contents spilled onto the extra petri dish, also add those to the vial 
Store screw cap tubes and vials at room temp 
Rinse off plate with water to remove excess ethanol & wipe off forceps with ethanol 
Turn off microscope 
HotSHOT extraction
Follow the HotSHOT method
Citation
Truett, G. E., Heeger, P., Mynatt, R. L., Truett, A. A., Walker, J. A., & Warman, M. L. (2000). Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques.
LINK
This method was applied to zooplankton eggs in 2008
Citation
Montero‐Pau, Javier, Africa Gómez, and Joaquín Muñoz (2008). Application of an inexpensive and high-throughput genomic DNA extraction method for the molecular ecology of zooplanktonic diapausing eggs. Limnology and Oceanography: Methods .
LINK
This method was applied to fish eggs in 2018
Citation
Makenzie Burrows, Jeremy S. Browning, Mya Breitbart, Steven A. Murawski, Ernst B. Peebles (2018). DNA barcoding reveals clear delineation between sp. Fisheries Oceanography.
LINK

Make Alkaline lysis buffer
-Add 25 ml of PCR water ReagentWater DNA Grade DNASE Protease freeFisher ScientificCatalog #BP24701
-Add 62.5 µl of 10 M NaOH (base cabinet) 
Reagent10 M NaOHMerck MilliporeSigma (Sigma-Aldrich)Catalog #72068
-Add 10.0 µl of the 0.5 M disodium EDTA (chemical cabinet-right side) 
Reagent0.5 M disodium EDTAMerck MilliporeSigma (Sigma-Aldrich)Catalog #4055
-Make fresh every 1-2 months 
-Stored at room temperature 

Make Neutralization reagent
-Add 24 ml of PCR water 
ReagentWater DNA Grade DNASE Protease freeFisher ScientificCatalog #BP24701
-Add 1 ml of 1 M Tris-HCl
Reagent1 M Tris-HClFisher ScientificCatalog #BP2473-1
-Stored at room temperature 
Pick individual eggs into individual PCR tubes (use PCR strips) using a sterile pipet tip (10-100 ul pipette depending on size of egg), remove excess ethanol 

This can be difficult! Tips and tricks:
-You need to pick the right size tips to get the eggs. Pick a tip that is slightly larger than the eggs you are trying to pick up
-The whole process is done with pressure
-Push out all the air in the pipette tip before sucking up the egg
-Keep pressure on the egg or it will come off the tip as you pull it from the tube
-If you accidentally suck up an egg within the tip, don’t panic!
-Gently push the egg out of the tip by flushing it with ethanol up and down slowly to avoid popping it
-If it is really stuck, you can cut off the tip of the tip and try again

Equipment
PCR tubes
NAME
Tubes
TYPE
Genesee
BRAND
22-705A
SKU

Add 50 µl of alkaline lysis buffer and crush egg against side of tube using a sterile toothpick or pipette tip
-Sterilize toothpicks in plastic small tri-pour on dry cycle in Autoclave 
- If you struggle to pop the egg, try removing the liquid, popping the egg, then re-adding the liquid
Incubate tubes at 95 C for 30 minutes 
-Turn on thermocycler (back right) or any block incubator 
-Click incubate – set 95 C plate and 56 C top without timer (infinity sign) 
-Make sure tube caps are tight! They will pop off it they are not secured 
-Set a timer for 29 minutes and 30 seconds so you have time to take it out 
Incubation
Temperature
Cool tubes on ice for 3-4 minutes, then centrifuge briefly to spin down any condensation 
Temperature
Add 50 µl neutralizing reagent to each tube 
Vortex the tubes to mix and centrifuge briefly.  This is your DNA template, use 2 µl for PCR or freeze at -20C for long term storage
-To store in the freezer, label a box with the year, your initials, and fish eggs 
PCR (Polymerase Chain Reaction)
Fish egg primer cocktail sequences:
VF2_t1 - TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC
FR1d_t1 - CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA
FishF2_t1 - TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC
FishR2_t1 - CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA

New primers that need to be reconstituted
- Add x μl of DNA free water (equal to the number of ng DNA on each primer tube) to dry primer powder
- Vortex until powder dissolved, spin down

Primer dilution
- Add 100 μl of each primer to a 1.5 ml tube, then add 600 μl DNA free water
- This can be done with smaller aliquots if you are low on primer stock
- Ex: Add 25 μl each primer and 150 μl water (Makes 10 μM primers)
Citation
Natalia V. Ivanova, Tyler S. Zelmak, Robert H. Hanner, Paul D. N. Herbert (2007). Universal primer cocktails for fish DNA barcoding. Molecular Ecology Notes.
LINK

Reagents needed:
ReagentBSA 20 mg/mLFisher ScientificCatalog #FERB14 ReagentDntpsGenesee ScientificCatalog #42-403
ReagentWater DNA Grade DNASE Protease freeFisher ScientificCatalog #BP24701
ReagentRed Taq & Buffers (NH4, MgCl2)Genesee ScientificCatalog #42-401R

Turn on thermocycler & prepare program
(Makenzie's folder - "Fish45")
94 C for 2 min
45 cycles of
94 C for 30 sec
52 C for 40 sec
72 C for 1 min
72 C for 10 min
Bleach & UV hood, pipets, and rack
Fill small cooler 1/3 full of ice
Defrost DNA on top of ice (may need to flick to mix occasionally)
Put Red Taq buried in ice
Defrost other reagents on bench until completely defrosted - primers, dNTPs, NH4, MgCl2, BSA
Optional - roll reagents in hands to warm faster
Vortex and spin down all reagents EXCEPT DNA (flick and spin) & Red Taq (only spin down)
While waiting for defrosting to happen, label all tubes in numerical order and include a negative control (-)
PCR tubes are small. Write station number and date at the top of the tubes, then sample numbers on middle of tubes.

Tube label example

Equipment
PCR tubes
NAME
Tubes
TYPE
Genesee
BRAND
22-705A
SKU
If using a 96 well plate, label the side with the date, stations, initials. Fill out a form like below to orient the order of your samples.

12345
A
B
C
D
E
F
G
H
678910
A
B
C
D
E
F
G
H
1112
A
B
C
D
E
F
G
H

Equipment
PCR plate
NAME
Eppendorf
BRAND
0030531043
SKU


Note
Work quickly! Temperature sensitive products (DNA & taq) need to be kept on ice
Prepare master mix for x templates, 1 negative, and 1 extra
For 96 well plates, use 100x to account for loss in the multichannel pipette reservoir

Example for 50 μl PCR reaction (1x)

Water - 38 μl
10X NH4 Buffer - 5 μl
50 mM MgCl2 - 1.5 μl
BSA - 0.5 μl
10 μM Primers** - 1 μl
10 mM dNTPs - 1 μl
Taq - 1 μl
Template - 2 μl (for each tube with different template DNA)

Mix all reagents together in appropriate size tube (except DNA)
Pipette 48 μl of master mix into each PCR tube
Add 2 μl DNA template into each PCR tube (matching up egg numbers) except the negative control
Flick tubes and spin down in centrifuge
(PCR plates need to be covered with foil and spun down as well)
Put everything in a cooler and bring to the PCR room (only bring tubes inside room)
Add samples to thermocycler & begin cycle (double check it is running before you leave)
Take off your gloves, retrieve cooler/racks and clean up in main lab (put away reagents, dump ice, bleach/UV hood)
Duration02:00:00
Incubation time
Taking out samples:
Press Enter to exit reaction (make sure it is on your program – view at top of screen)
- If it is not on your program, use the arrow keys to get to the bottom and press enter to
select your thermocycler
- Open thermocycler and remove your products
- Turn off thermocycler (unless it says otherwise)!
Place PCR tubes in baggie or rack to store in -20 C freezer or run a gel immediately
Gel Electrophoresis
Make gel while waiting for thermocycler to finish
Note
● Gel is good for up to 4 days
● Change TAE buffer if needed (check for goop and particles to see if clean/clear)


Agarose gel concentration, size, and measurements
Choose your gel rig size and 1.5% agarose gel. Follow measurements on diagram above.
Your size of gel depends on how many samples you are running. Small rig (150 mL) for just a
couple strips, larger rig (350 mL) for full PCR plate.
Add selected measurement of ReagentAgarose powderApexBio TechnologyCatalog #20-101 and 1X TAE buffer (mL) to Erlenmeyer flask (size depending on how much liquid you add) and swirl gently.
Do not fill more than halfway or it will overflow when boiling.
Note
Making 50X and 1X TAE
Ingredients:
Tris Base, 242g (Fisher #BP152-1, 1kg), Tris – EDTA 1x solution, pH 8.0, 100 mL (Fisher #BP2473-500, 500 mL), 100% Glacial acetic acid, 57.1 mL (Fisher #BP1185-500, 500 m)
50X TAE Buffer Protocol (concentrate):
1. In main lab, pour acetic acid into two falcon tubes using hood, then bring to PCR room
2. In PCR room, measure 500 mL of DI water in graduate cylinder, then pour into large,
clean bottle
3. Weigh out 242 g of Tris base using large weigh boat
4. Add Tris base to bottle and shake to dissolve powder. NOTE: This takes a long time!
Shake it, wait an hour, shake, wait an hour, etc (about 2-3 hours).
5. When Tris base is fully dissolved, pour 100 mL Tris EDTA into the bottle using a
graduated cylinder
6. Add acetic acid to bottle and mix gently (it will warm up a bit)
7. Pour solution into 1 L graduated cylinder, then fill to 1 L using DI water
Pour back into bottle, label and date it

1X TAE Buffer Protocol (big carboy):
1. Fill empty carboy to 19.6 L line with DI water
2. Add 400 mL of TAE 50X Buffer
3. Mix carboy by gently rocking on edge of counter
4. Leave top slightly unscrewed to allow for flow out of spigot
5. Date and initial with lab tape
Calculation: C1V1 = C2V2
(50x) V1 = 1X (20 L)
V1 = 400 mL of TAE 50X Buffer
V2 = 20 L – 400 mL = 19.6 L DI Water
Sources: Sambrook & Russell, Molecular Cloning, Vol. 1, 3rd edition, 5.8

Microwave solution for 1 minute
Wearing heat gloves, swirl flask gently
Microwave again for 45 sec (or until boiling), swirl again
Set up gel siding and combs (tape sides if needed)
Once flask has cooled for a few minutes and is cool enough to touch the bottom for 10 sec, add ReagentEthidium Bromide (1% Solution/Molecular Biology)Fisher ScientificCatalog #BP130210 (follow diagram in step 45)
Warning - Ethidium bromide is cancerous. Be careful to open lid and do not breath in fumes.
Swirl gently and pour immediately into gel holder
Pop or move any bubbles with a pipette tip
Add desired amount of combs with room between rows for gel to run
Wait Duration00:20:00 for gel to harden

Pull gel combs directly up to remove and remove siding or tape
Add 1X TAE buffer to cover gel in gel box at least 1/2 inch
Place lid on gel rig, check connection of leads is in correct direction (black/neg on left and red/positive on right) before plugging into the power supply

Gel rig diagram

Gather your thawed PCR products and DNA ladder (fridge with pink cap) ReagentGeneRuler DNA LadderFisher ScientificCatalog #SM0334
Ladder diagram

Add ladder to edges and your samples in the middle of each row
Turn on power supply (back or side)
Set machine to 120V
Run for Duration01:00:00
Check to make sure bubbles are running up both sides

Turn off power supply
Cut gel piece out with razor blade if needed or remove full gel to bring to imager
Take your gel photo
Clean gel imager base with Ethanol and Kim wipes before placing gel
  • Turn on UV light with door open
  • Add gel with wells towards back and centered
  • Open imager program
  • Adjust lens at top if need to zoom in or out
  • Acquire image
  • Edit for better color
  • Print to Mitsubishi
  • Take out gel with gloved hand
  • Turn off machine and keep door open
  • Save picture to your computer folder with date
Throw gel away in biohazard
Label your gel image and place it in your notebook
  • Use sharpie to label numbers, ladder and negative control
  • Mark positives (about 600-700 bps long)
  • Note - all wells should have primer dimers at the bottom (about 100 bp long)
Sending samples for sequencing
Prepare a 96 well plate with uncleaned PCR products in any order you choose, preferably
all the same site per plate, make sure to write this order down in a table like this:
12345
A
B
C
D
E
F
G
H
678910
A
B
C
D
E
F
G
H
1112
A
B
C
D
E
F
G
H

Place shipping caps ReagentFlat PCR Caps, strips of 12Fisher ScientificCatalog #AB0851 on plate, then add foil sticker ReagentAlumaSeal II Sealing FilmsFisher ScientificCatalog #AF100
Label with date and name matching to your form.
Note
This can be a pain… use a tape dispenser or sharpies to help push them down

Send an email with DNA order forms filled out to the best of your ability (TacGen), making sure it
says unpurified PCR under “type”, primers M13 F (-20), 700-800bp
Ship samples overnight in a box with bubble wrap or stuffing & the printed form with
samples
Note
Your samples do not need to be cold.
Do not ship on a Friday unless you have okayed it with TacGen

Get account number and shipping information from Lab Manager.
Sequence data processing
Open program: Geneious 7.1.9
Create folder or continue under your name folder
Right click “local” and create new folder
Drag and drop or import your sequences (.ab1 files) into your new folder
(Ctrl a to select all, ctrl c to copy, ctrl v to paste)
Once sequences imported, select all (ctrl a)
Select Annotate & Predict tab at top
  • Trim ends...
  • Select the following only:
Remove new trimmed regions from sequences
Trim primers: Allow Mismatches: 5
Minimum match length: 5
Error Probability Limit: 0.05
Trim 5’ End – At least 3 bp
Trim 3’ End – At least 3 bp
OK
Click off the sequence names to save
Reselect all sequences (cnrl a)
Select Align/Assemble program at top left
  • De Novo Assemble
  • Rename “Assembly name”
  • Select the following:
Assembly by 1st part of name, separated by – (Hyphen)
Assembler: Geneious
Sensitivity: Custom Sensitivity
Do not trim
Save assembly report
Save list of unused reads
Save in sub-folder
Save contigs
Allow gaps – max per read 5%
Minimum overlap – 100
Word length – 10
Maximum mismatches per read – 1%
Maximum gap size – 5
Minimum overlap identity – 99%
Index word length – 10
Reanalyze threshold – 0
Maximum ambiguity – 16
Speed 5
OK
How to save sequences:
Go to new folder created
Select all Contigs
File – Export – Consensus sequences
Highest quality, assign quality – total
OK
Create sequence list
Save as FASTA
Select unused reads
File – Export – Selected Documents
Save as FASTA
Create a spreadsheet with the following columns:
Station, Egg Number, Sequence name, Scientific Name, Number of eggs, Probability of Placement, Notes, Sequence
Click Identification tab - select species level identification
Copy and paste TXT files into BOLD box
Note
BOLD will not work on sequences less than 80 bp. You can try to identify these in NCBI blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi). This can take some time. Email me results box is an option.

Download results summary
Populate your spreadsheet with the scientific name of the best identification and probability of placement
Note
Scroll down on BOLD to check species IDs are accurate - sometimes they can be off due to private identifications.
Add additional species IDs in alphabetical order using a “/” if the match does not state “This
identification is solid unless there is a very closely allied congeneric species that
has not yet been analyzed.

Optional: add common names in your spreadsheet from FishBase (https://www.fishbase.se/search.php)
NCBI blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi) any sequences that were not found in BOLD
Click blast, put the top hit in the spreadsheet and add in percent identities, make note it was "blasted"
Once you have finished matching IDs, make a summary chart
Do not include species IDs less than 97% (not considered trusted)
Add sequences to your spreadsheet from the TXT file by copying and pasting
Citations
Step 14
Makenzie Burrows, Jeremy S. Browning, Mya Breitbart, Steven A. Murawski, Ernst B. Peebles. DNA barcoding reveals clear delineation between sp
https://doi.org/10.1111/fog.12404
Step 23
Natalia V. Ivanova, Tyler S. Zelmak, Robert H. Hanner, Paul D. N. Herbert. Universal primer cocktails for fish DNA barcoding
https://doi.org/10.1111/j.1471-8286.2007.01748.x