License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited Protocol status: WorkingWe use this protocol and it's working
Created: October 18, 2022
Last Modified: March 27, 2023
Protocol Integer ID: 71489
Keywords: ball python dna amplification, tfec primers pcr amplification, piedball morph in ball python, piedball morph, pcr amplification, ball python, aactcagagcactccatgacc right primer, python regius, dna, genotype, primer, left primer, tfec, amplification