Icon indicating open access to content
QR code linking to this content
Protocol CitationSachin Chalapati, Conor Crosbie, dixita limbachiya, Nimesh Pinnamaneni 2025. Direct oligonucleotide sequencing with nanopores. protocols.io https://dx.doi.org/10.17504/protocols.io.n2bvjexzbgk5/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 25, 2025
Last Modified: July 25, 2025
Protocol  Integer ID: 223215
Keywords: minion platform from oxford nanopore technology, minion platform from oxford nanopore, biological nanopore sensor, strand oligonucleotide, nanopore, nanopore raw data, short oligonucleotide, direct sequencing of ssdna, direct oligonucleotide, layer of biological nanopore sensor, oxford nanopore technology, oxford nanopore, direction via nanopore, novel applications in dna data storage system, generation dna sequencing, stranded nucleic acid species, dna data storage system, sequencing adapter, direct sequencing, strands of dna, unamplified dna fragments with minimal step, nucleic acid species, prepared dsdna, unamplified dna fragment, sequencing, dna, sequencing method, ssdna, rna, valid read by the minion platform, strand synthesis, phosphoramidite synthesis yield, single raw sequence file, complimentary strand, minion platform, estimate of phosphoramidite synthesis yield
Abstract
Third-generation DNA sequencing has enabled users to sequence long, unamplified DNA fragments with minimal steps. Direct sequencing of ssDNA or RNA gives valuable insights like base-level modifications, an estimate of phosphoramidite synthesis yield and analysis of strand quality, without the need to add the complimentary strand. Direct sequencing of single-stranded nucleic acid species is challenging as they are non-compatible to the double-stranded sequencing adapters used by the manufacturers. The MinION platform from Oxford Nanopore Technologies performs sequencing by passing single-strands of DNA through a layer of biological nanopore sensors, although the sequencing is performed on single-strands of DNA, the recommended template by the instrument manufacturer is still double-stranded. We have identified that the MinION platform from Oxford Nanopore can perform sequencing of short, single-strand oligonucleotides directly without amplification or second-strand synthesis by performing a single annealing step before library preparation. Short 5’ phosphorylated oligos when annealed to an adapter sequence can be directly sequenced in the 5' to 3' direction via nanopores. Adapter sequences were designed to bind to the 5’ end of the oligos and to leave a 3’ adenosine overhang after binding to their target. The 3’ adenosine overhang of the adapter and the terminal phosphate makes the 5’ end of the oligo analogous to an end-prepared dsDNA, rendering it compatible with ligation-based library preparation for sequencing. An oligo-pool containing 42,000, 120 nt orthogonal sequences were phosphorylated and sequenced using this method and ~90% of these sequences were recovered with high accuracy using BLAST. In the nanopore raw data, we have identified that empty signals can be wrongly identified as a valid read by the MinION platform and sometimes multiple signals containing several strands can be fused into a single raw sequence file due to segmentation faults in the software. This direct oligonucleotide sequencing method enables novel applications in DNA data storage systems where short oligonucleotides function as the primary information carriers.
Materials

Oligonucleotides:

ABCD
Oligo_IDSequence (5' --> 3')ConcentrationProcurement
INS3/5Phos/GCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGCAGCCCCACACCCGCCGCCTCCTGCACC/3SpC3/100 uMIDT (Ultramer)
INS3 RCCCCGCCCAGCA100 uMIDT (Standard desalting
EINS3/5Phos/AGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGTGAA/3Phos/100 uMIDT (Ultramer)
EINS3 RCCTTGGGTGTGTAGAAGAAGCCTA100 uMIDT (Standard desalting
ArcFP_MoSS5ACTGAGGTTGTAATCTGCGTTGTAGA100 uMIDT (Standard desalting
3xr6 oligo-poolSee supplementary table10 ng/ulTwist (Oligo Pools)


Enzymes and buffers:
T4 Polynucleotide Kinase - 500 unitsNew England BiolabsCatalog #M0201S
Blunt/TA Ligase Master Mix - 50 rxnsNew England BiolabsCatalog #M0367S
TE pH 7.5 IDT TechnologiesCatalog #11-01-02-02
Qubit™ ssDNA Assay KitThermo Fisher ScientificCatalog #Q10212
Nuclease Free WaterIDT TechnologiesCatalog #11-04-02-01



Wash kit:
Monarch® PCR & DNA Cleanup Kit (5 μg)New England BiolabsCatalog #T1030



Sequencing kit:
Ligation sequencing kit 1DOxford Nanopore TechnologiesCatalog #SQK-LSK109


Equipment:


Open qPCR (Single Channel) - ChaiBio - E013101
Microcentrifuge - Dlab - D3024
Qubit 4 - ThermoFisher - Q33226

Sequencer
MinION - Oxford Nanopore Technologies (ONT) - MIN-101B
Normalization
Normalize 3xr6 dried oligo-pool to 0.25 uM with TE buffer and verified with Qubit 4 using Qubit ssDNA Assay Kit
INS3 and EINS3 are diluted from their stock concentrations to 0.5 uM with TE buffer and verified with Qubit 4 using Qubit ssDNA Assay Kit
INS3 RC, EINS3 RC and ArcFP oligos are normalized by the supplier at 100 uM concentration and are diluted to 1 uM concentration.
Phosphorylation of 3xr6
50m
Mix the following reagents into a PCR tube.

AB
ReagentVolume µl
3xr6 oligo-pool8
T4 PNK reaction buffer2.5
10 mM ATP2.5
T4 PNK0.5
Nuclease-free water (NFW)11.5


Incubate at 37 °C for 00:30:00

30m
Heat inactivation at 65 °C for00:20:00

20m
The mixture is washed using Monarch spin columns with the standard oligonucleotide cleanup protocol. The purified DNA is eluted into 9 ul of IDTE instead of the given Elution buffer.
Library preparation of INS3
32m
Create a triplicate of the following reaction mix:


AB
ReagentVolume µl
0.5 uM INS3 0.5
1 uM INS3 RC 0.5
NFW2

The reaction mixtures are heated to 94 °C for 00:02:00 and gradually cooled to room temperature for annealing.

2m
5 µL of AMX from the ligation sequencing kit is added to each of the tubes.
5 µL of Blunt/TA master mix is added to each of the tubes.

Tubes are incubated at room temperature for 00:10:00

10m
Three new MinION flow cells are used to sequence each reaction mix of the triplicate and the sequencing is performed with the standard parameters for 00:20:00

20m
Library preparation of EINS3
32m
Create a triplicate of the following reaction mix:


AB
ReagentVolume µl
0.5 uM EINS30.5
1 uM EINS3 RC 0.5
NFW2


The reaction mixtures are heated to 94 °C for 00:02:00 and gradually cooled to room temperature for annealing.

2m
5 µL of AMX from the ligation sequencing kit is added to each of the tubes.
5 µL of Blunt/TA master mix is added to each of the tubes.

Tubes are incubated at room temperature for 00:10:00 .

10m
Three MinION flow cells from the INS3 run are used to sequence each reaction mix of the triplicate and the sequencing is performed with the standard parameters for 00:20:00 .
20m
Library preparation of 3XR6
4h 12m
Elution of the phosphorylation step is split 3-ways for triplicate sequencing runs. A triplicate of the following reactions is performed:

AB
ReagentVolume µl
Elution of 3XR6 phosphorylation3
1 uM ArcFP1


The reaction mixtures are heated to 94 °C for 00:02:00 and gradually cooled to room temperature for annealing.

2m
5 µL of AMX from the ligation sequencing kit is added to each of the tubes.
5 µL of Blunt/TA master mix is added to each of the tubes.

Tubes are incubated at room temperature for 00:10:00 .

10m
Three new MinION flow cells are used to sequence each reaction mix of the triplicate and the sequencing is performed with the standard parameters for 04:00:00 .

4h