Protocol Citation: Erika Bujaki, Ben Bellekom, Alison Tedcastle, Jasmaine Lee, Thomas Wilton, Adnan Khursid, YASIR ARSHAD, Masroor Alam, Joyce Akello, Nick Grassly, Catherine Troman, Alex Shaw, Andrew Rambaut, Aine OToole, C Ansley, Dimitra Klapsa, Javier Martin 2026. Direct Detection of poliovirus and Nanopore Sequencing (DDNS) - Environmental Samples. protocols.io https://dx.doi.org/10.17504/protocols.io.8epv5r1wjg1b/v2Version created by Ben Bellekom
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 07, 2026
Last Modified: July 01, 2026
Protocol Integer ID: 316554
Keywords: environmental surveillance, sewage testing, poliovirus detection, nanopore sequencing, direct detection, amplification of poliovirus nucleic acid, poliovirus nucleic acid, poliovirus molecular detection sensitivity, method for magmax viral rna isolation, magmax viral rna isolation, direct detection of poliovirus, poliovirus, extraction fresh so the rna, nanopore sequencing, viral rna, starting wastewater concentrate sample, sequencing library preparation, rna sample, use with oxford nanopore kit14 chemistry ligation, concentrated sewage sample, oxford nanopore kit14 chemistry ligation, sequencing adapter ligation, pcr amplicon, gel electrophoresi, rna, molecular detection sensitivity, barcoded vp1 amplicon, sequencing reagent, purification, vp1 amplicon, environmental samples this protocol, extraction, sequencing mix, large volume extraction protocol, gridion sequencer, filtration system, step amplification in triplicate
Funders Acknowledgements:
MHRA
Bill and Melinda Gates Foundation
Abstract
This protocol covers amplification of poliovirus nucleic acid from concentrated sewage samples following enrichment by sewage concentration and RNA purification with the subsequent sequencing of barcoded VP1 amplicons. An overview of the full procedure if shown in Figure 1.
The protocol was successfully tested on concentrates prepared with two-phase separation method, spin-column concentration and bag-mediated filtration system. Poliovirus molecular detection sensitivity will inherently depend on what viral content had been successfully captured in the starting wastewater concentrate sample.
Viral RNA should be purified in duplicates from each concentrate following the method for MagMAX Viral RNA Isolation Large volume extraction protocol using 1.2 mL of concentrate for each extraction. It is recommended to perform the extraction fresh so the RNA can be used immediately after purification. Each RNA sample is then subjected to two step amplification in triplicates using a semi-nested PCR approach. A 1:10 dilution using nuclease free water of the first round PCR is included to increase assay sensitivity and reduce chimera formation. Once controls are confirmed by gel electrophoresis, the PCR products are carried forward for nanopore sequencing. The PCR amplicons are pooled and purified before end-repair and dA-tailing. Following sequencing adapter ligation, the sequencing library is prepared and loaded onto the flow cell.
This protocol is for use with Oxford Nanopore kit14 chemistry ligation sequencing reagents and the prepared sequencing mix can be run on MinION Mk1B or GridION sequencer.
Figure 1. Overview of ES-DDNS protocol
Materials
Equipment required:
Pipettes P10, P20, P200, P1000
Pipette tips P10, P20, P200, P1000
1.5 ml Eppendorf DNA LoBind microcentrifuge tubes
Thermal cycler
0.2 ml thin-walled PCR tubes/strips/plate
Microfuge
Vortex mixer
Microplate centrifuge
Magnetic racks of two types: accommodating PCR plate/strips and 1.5 mL tube(s)
Gel electrophoresis equipment or Tapestation
Qubit fluorometer, with assay tubes
Nanopore Sequencing device (Mk1B/Mk1C or GridION) with FLO-MIN114 / R10.4.1 flow cell
Gel electrophoresis capacity to visualise PCR products
Reagents required:
Primers
SuperScript‱ III One-Step RT-PCR System with Platinum‱ Taq DNA Polymerase (ThermoFisher, 12574026)
DreamTaq Hot Start PCR Mastermix (ThermoFisher, K9011 or K9012)
For direct detection of poliovirus in waste water we recommend to perform the large volume viral RNA extraction protocol on each sewage concentrate in duplicates. Each RNA sample should be analysed in triplicate PCRs, resulting in a total of 6 sequencing results for each sewage concentrate.
This protocol describes steps following viral enrichment by sewage concentration and RNA purification. For large volume RNA extraction from wastewater concentrates using MagMAX Viral RNA Isolation Kit follow steps in: https://dx.doi.org/10.17504/protocols.io.81wgbzdr3gpk/v3
Notes for using this protocol:
Avoid pipette mixing of samples whenever possible, especially for RNA and long amplicons to minimise unwanted shearing and mix instead by gently flicking tubes or manually rotating plates.
Do not vortex enzyme tubes and always add ligase enzymes to the reaction mixtures last to reduce homopolymer formation. When precipitate is visible in buffers, warm to room temperature and dissolve by pipetting or vortexing.
Overdrying the pelleted beads can result in loss of long fragments due to inefficient elution as the nucleic acid will be bound to the beads too strongly. Always try to remove excess alcohol or Short Fragment Buffer at the end of wash steps using a small pipette tip and dry pellets for a short period of 30s to 1 min only to avoid cracking and overdrying.
Sample Organisation
Try not to group samples from the same geographic area together. This helps detect any potential cross-contamination because identical sequences are then unlikely to be detected in samples with consecutive barcodes that are adjacent to one another on the 96-well plate
Record sample data, including barcodes, EPID, country of origin, collection site, date of sample collection and receipt, date of RNA extraction and the order for the samples in a barcode csv file.
Here is a template csv file: samples_csv_ES_template.csv677B
It is advised that you edit the name of the file so it is unique for each run. If you edit any column headers in the csv, do not use any spaces or special characters in the column header.
You should also include all positive and negative controls in your list of samples. A positive control (Coxsackievirus A20 DDNS assay positive control material provided by MHRA and prepared according to instructions) and negative extraction control (nuclease free water) should each be included at least in the first and last RNA extraction batches of the day. The positive control should be called "positive_[date of reconstitution]_[candidate]" in the sample column. The negative control's name should include "negative" in the sample column. If there are multiple positive or negative controls, these can be defined by adding an underscore and a number.
If any samples are repeats from a previous run, note this down in the "IsQCRetest" column and note down the original run number in the column "IfRetestOriginalRun.
Viral Nucleic Acid Amplification - First Round, RT-PCR
Calculate the number of reactions to prepare.
Each sewage concentrate RNA should be tested for amplification in triplicates to increase detection sensitivity. Positive and negative RNA extraction controls should also be included, along with additional PCR negative controls. For PCR positive control use RNA that was previously successfully amplified and stored appropriately, this can ideally be your positive control RNA from your previous run.
2m
Wipe down lab bench surfaces and pipettes with 70% ethanol and an RNAse specific cleaning agent, such as RNAse Zap.
Prepare a master mix using the reaction volumes detailed in the table below for the number of reactions including the RNA extraction control, assay positive control and PCR negative control with allowing extra for pipetting loss. The reaction mix and SSIII enzyme are provided in SuperScript III One-Step RT-PCR System with Platinum TaqInvitrogen - Thermo FisherCatalog #12457-026
A
B
RT-PCR
Per reaction (µL)
2x Reaction Mix
12.5
SSIII Platinum Taq Enzyme mix
1
Reverse primer: AriR/Cre & nOPV-MM-R (10µM)
1
Nuclease free Water
1.5
Total volume
16
Reverse transcription reaction mix
RT-PCR primers (to be used as separate 10 µM working stocks):
Forward: Y7 [TCAATACGGTGTTTGCTCTTGAACTG]
Reverse: AriR/Cre [TCAATACGGTGTTTGCTCTTGAACTG] (Arita et al. 2015)
& nOPV-MM-R [TCGATACGGTGCTTGGATTTAAATTG]
Note
The reverse primers include both a Pan-enterovirus primer and a primer which allows amplification of nOPV2. These are mixed to make a working solution with each oligo at 10μM .
For example, 10μL of each 100μM reverse primer stock is added to 80μL of nuclease free water to create 100μL of a working solution with each primer at 10μM. Any leftover primer working stock can be frozen for future use.
20m
Briefly vortex and centrifuge the Master mix and aliquot 16 µL into each PCR tube.
5m
Add 8 µL of sample RNA or nuclease free water for PCR negative control. Add 4 µL of control RNA for the positive control and 4 µL of nuclease free water.
5m
Flick tubes to gently mix the content, then centrifuge them briefly and incubate at 50 °C for 30 minutes, with cooling down to 10°C at the end of the program.
Note
Only the reverse primers are used for the Reverse Transcription step. The forward primer is added before starting the PCR cycles.
33m
Briefly centrifuge tubes after the RT step and add 1 µL of the forward primer (Y7) 10 µM working stock to each tube using new pipette tip for each addition.
5m
Amplify using the following cycling conditions:
A
B
C
D
CYCLE
STEP
TEMP (°C)
TIME
1
Initial Denaturation
94
2 minutes
30
Denaturation
94
15 seconds
Annealing
55
30 seconds
Extension
68
2 minutes 30 seconds
1
Final
Extension
68
5 minutes
-
Hold
10
-
Thermal profile for first round of PCR - half capsid
Amplicon size of the first PCR is ~2kb.
3h 20m
Continue to the dilution of the PCR round one immediately or store them in the fridge for short term or frozen for long term.
Dilution of PCR Round One
To improve sensitivity in complex environmental samples, we include a 1 in 10 dilution step of the first round PCR product. The diluted PCR product is then used as template for the second round PCR.
Label a new 96 well PCR plate or 0.2 µL strip tubes and aliquot 18 µL of nuclease free water into a sufficient number of wells or tubes to accommodate all samples from the first-round PCR, including the positive control.
Centrifuge the first round PCR product to collect content. Transfer 2 µL of each sample/positive control into their respective dilution well or tube.
Gently pipette mix each well or tube and centrifuge to collect content. Continue immediately to PCR Round Two.
PCR Round Two - semi-nested VP1 amplification
DDNS_Primer_Sequences.xlsx20.3KB
VP1 amplification is performed using barcoded primers as described in Dataset_S1 in Shaw et al 2020. These should be ordered in a 96-well plate layout and the forward and reverse primers premixed to a concentration of 5 μM working stock of each primer.
Semi-nested VP1 primers:
Forward: barcoded Y7 [GGGTTTGTGTCAGCCTGTAATGA]
Reverse: barcoded Q8 [AAGAGGTCTCTRTTCCACAT]
To allow a simplified protocol, we use a 96-well primer plate with 5µM barcoded Y7 primer and 5µM barcoded Q8 primer in each well.
Each well contains Q8 and Y7 primers with the same unique barcode e.g A1 = Y7 with barcode 1 and Q8 with barcode 1, A2 = Y7 with barcode 2 and Q8 with barcode 2, etc.
The full set of 96 barcoded primer sequences are shown in Dataset_S1 of Shaw et al, 2020 and in the attached spreadsheet. To prepare 200 µL primer working stock at 5 µM for each oligo, add 10 µL of the 100 µM master primer stocks to 180 µL nuclease free water. Any leftover primer working stock can be frozen for future use, but we recommend aliquoting into smaller volumes (e.g. 10-20 µL per well) to reduce repeated freeze-thaws.
Prepare a mastermix as described below using DreamTaq PCR Master Mix (2X)Thermo FisherCatalog #K1071 and multiplying up for the number of reactions required, including an additional VP1 PCR negative control and allowing extra for pipetting loss:
A
B
Second PCR
Per reaction (µL)
DreamTaq 2x Hot Start Master mix
12.5
Water
8.5
Total volume
21
Second PCR reaction mix
20m
Vortex the mastermix briefly and centrifuge to collect content.
10s
Aliquot 21 µL of mastermix for each reaction well and add 2 µL of the combined forward and reverse barcoded primers ensuring a different barcode is used for each sample.
5m
Add 2 µL of the diluted first round PCR product from the centrifuged dilution wells. Add nuclease free water for the PCR negative control.
3m
Amplify using the following cycling conditions:
A
B
C
D
CYCLE
STEP
TEMP (°C)
TIME
1
Initial Denaturation
95
2 minutes
30
Denaturation
95
30 seconds
Annealing
55
30 seconds
Extension
72
1 minute
1
Final Extension
72
10 minutes
-
Hold
10
Thermal profile for second round of PCR - VP1
2h
Once the PCR is finished, check to see if any reactions have evaporated, if so note this down in the sample csv.
Input into your csv the date that the PCR reactions were carried out.
Check all positive and negative controls from both first and second round PCR on a 1% agarose gel.
All samples can be marked as “Pass” for the PositiveControlCheck in the barcodes csv if all positive controls extracted on the same day show a VP1 band on the gel. The expected VP1 band is around 1.2kb.
All samples can be marked as “Pass” for the NegativeControlCheck if all negative controls extracted on the same day show no VP1 band on the gel.
If any positive controls fail, or any negative controls have a band, samples should be marked as "Fail".
If the positive control check failed, check the gel for the positive control first round PCR product. The expected half-capsid band for first round PCR is around 2kb.
If there is a band in the positive control first PCR, discard the VP1 amplicons and repeat the second round VP1 PCR.
If there is no band, repeat the first and second round PCR.
If there is no band visible after repeating the VP1 reaction, repeat the RNA extractions after checking the RNA extraction kit is being used correctly and has not expired.
If the negative control check is failed, identify which step contamination was introduced and repeat from that step.
If there is a band in the extraction negative control, repeat from the RNA extraction step.
If there is a band in the first round PCR negative control, repeat from the first round PCR step (Step 2).
If there is a band in the second round PCR negative control, repeat from the second round PCR step (Step 3).
If the negative control still shows a band on a gel or tapestation:
Thoroughly clean the PCR and RNA extraction workstations.
Replace each of the First Round and VP1 reagents in turn whilst performing blank reactions to determine a contaminated reagent.
Perform an additional Negative RNA extraction to confirm that that RNA extraction kit is not contaminated.
Note
To avoid cross contamination due to contaminated lab surfaces/equipment, we recommend giving the PCR and RNA workstations a thorough clean every 5 runs.
Library Preparation for Nanopore Sequencing: Pooling, End-prep, Adapter ligation
Library Pooling:
Pooling and purifying barcoded amplicons.
Pool 2μL of each VP1 PCR product into a 1.5mL tube to concentrate with AMPure beads
Agencourt AMPure XPBeckman CoulterCatalog #A63880
Note
Change tips between the individual PCR reactions to avoid cross-contaminating them.
5m
Add a volume of room temperature AMPure beads equal to the volume of the pooled VP1 products and incubate at room temperature for 5 minutes. Flick gently after 2 minutes to aid binding.
e.g. 50 samples, 2µl each pooled = 100µl pool, so add 100ul AMPure beads
10s
Spin down the tube for 3 seconds then place on a magnetic rack until all the beads have formed a pellet and the solution is clear.
Note
If beads are accidentally collected during removal of supernatant, empty the pipette tip back into the tube. Centrifuge the tube again if necessary, place back on the magnet and wait for full separation of the pellet before trying removal again.
3m
Keeping the tube on the magnet, rinse the pellet by adding 200μL of 80% Ethanol to the tube (use more Ethanol if needed to cover the pellet), leave for 30 seconds, then remove the supernatant and discard.
1m
Repeat Step 7.4 to complete two rinses with 80% Ethanol.
1m
Spin down the tube for 3 seconds, place back on the magnet, then remove any remaining Ethanol with a small volume, fine pipette tip.
30s
Allow the pellet to air dry for 30 seconds or until all alcohol evaporated, but avoid over drying to the point of cracking or crumbling.
1m
Take the tube off the magnet and add 51μL of nuclease free water. Flick the tube to resuspend the beads and incubate at room temperature for 2 minutes.
3m
Remove 50μL of the eluted DNA and add to a clean labelled 0.2mL PCR tube.
30s
End-preparation:
Preparing the pooled and purified amplicons for sequencing adapter ligation.
Add the following reagents from NEBNext Ultra II End repair/dA-tailing ModuleNew England BiolabsCatalog #E7546 to the tube containing the 50 μL purified pool from Step 7.9 :
A
B
Component
Volume (μL)
UltraII End-prep reaction buffer
7
UltraII End-prep enzyme mix
3
Reaction mix for end-prep of pooled library.
1m
Mix gently by flicking the tube and spin down briefly to collect content.
10s
In the thermocyler, incubate for 5 minutes at 20°C followed by 5 minutes at 65°C
Note
Create an End-prep incubation program in the thermocycler: 5 min at 20°C followed by 5 minutes at 65°C, followed by cooling and holding at 10°C.
11m
Resuspend room temperature AMPureXP beads by vortexing and add 60 μL to a labelled clean 1.5 mL tube.
30s
Transfer the 60 μL End-prep reaction to the same tube and mix gently with the beads to allow the nucleic acid to bind. Incubate at room temperature for 5 minutes with flicking the tube gently after 2 minutes again to keep the mixture homogenous.
6m
Spin the tube briefly to collect content then place on the magnet, allowing the beads to pellet completely.
1m
Pipette off the supernatant without disturbing the pelleted beads.
30s
Keeping the tube on the magnet, rinse the pellet by adding 200μL of 80% Ethanol to the tube, leave for 30 seconds, then remove the supernatant and discard.
1m
Repeat Step 8.8 to complete two rinses with 80% Ethanol.
1m
Spin down the tube for 3 seconds, place back on the magnet, then remove any remaining Ethanol with a small volume, fine pipette tip.
30s
Allow the pellet to air dry for 30 seconds or until all alcohol evaporated , but avoid over drying to the point of cracking or crumbling.
1m
Take the tube off the magnet and add 61 μL of nuclease free water. Flick the tube to resuspend the beads and incubate at room temperature for 2 minutes.
3m
Spin down the tube briefly then place back on the magnet, allowing the beads to pellet completely until eluate is clear and colourless.
1m
Remove 60μL of the eluted DNA and add to a clean, labelled 1.5 mL Eppendorf DNA LoBind tube.
Note
End-prepped DNA library can be stored at 4°C for up to one week, however it is advised to continue the library preparation protocol as soon as possible.
30s
Sequencing adapter ligation:
Motor protein ligation to end-prepped library.
From NEBNext Quick Ligation ModuleNew England BiolabsCatalog #E6056 :
Spin down the NEB Quick T4 Ligase and place on ice
From Ligation Sequencing Kit V14Oxford Nanopore TechnologiesCatalog #SQK-LSK114 :
Spin down and thaw Ligation Adapter (LA) on ice.
Thaw Ligation Buffer (LNB) at room temperature, spin down, mix by pipetting, then place on ice.
Thaw Elution Buffer (EB), and Short Fragment Buffer (SFB) at room temperature, mix by vortexing then place on ice.
In preparation for the sequencing run, remove the Flush buffer (FCF), flush tether (FCT) and BSA from the freezer and thaw at room temperature. Once thawed, place on ice.
Take the Flow Cell (R10.4.1)Oxford Nanopore TechnologiesCatalog #FLO-MIN114 out of the fridge and open the plastic case to allow it reaching room temperature and letting any moisture evaporate.
3m
Prepare the following reaction mix for adapter ligation,by adding reagents to the 1.5mL tube with end-prepped DNA:
A
B
Component
Volume (μL)
End-prepped DNA
60
Ligation buffer (LNB)
25
Quick T4 Ligase
10
Ligation Adapter (LA)
5
Reaction mix for sequencing adapter ligation
2m
Mix gently by flicking the tube and spin briefly to collect tube content.
1m
Incubate the reaction at room temperature for 10 minutes.
10m
Library purification
Final bead cleaning of the library using Short Fragment Buffer (SFB) instead of Ethanol and Elution Buffer (EB) instead of water.
Note
This clean-up is different from previous bead purifications as it uses the ONT Short Fragment Buffer (SFB) and Elution buffer (EB) instead of 80% ethanol and water.
Vortex the AMPureXP beads to mix and add 40μL of the resuspended beads to the adapter ligation reaction tube from step 5 and mix the content by flicking the tube.
1m
Incubate mixture at room temperature for 5 minutes. Flick gently after 2 minutes ensuring homogenic mixture to aid binding.
5m
During this time, you can run your flow cell check
Start MinKNOW and insert your flowcell. In the MinKNOW software, navigate to the start panel then select flowcell check, then start. This will tell you how many pores are available for sequencing.
If a flow cell has less than 200 pores, do not use it and dispose of it according to ONT guidance. Take out a different flow cell and perform a flow cell check. The number of pores available in the flow cell you use for sequencing should be noted down in the sample csv in the column "PoresAvilableAtFlowCellCheck" and the flow cell ID should be recorded in the "FlowCellID" column. Also record the number of times the flow cell has been used previously in the "FlowCellPriorUses" column.
Note
If your flow cell has been used before and the flow cell check returns an unexpectedly low pore number, instead of running a flow cell check you can start a dummy sequencing run. Do this by selecting Start Sequencing, name the run "flowcell_check", select any kit, then set the time to 0.2 hours, then start the run. At the beginning of the run it will do a short flow cell check and give a more accurate number for the available pores. The result is shown on the pore scan results panel (the pore count is the sum of available pores and unavailable pores shown on the graph) and also in system messages.
Spin down the tube briefly then place on a magnetic rack allowing the beads to pellet completely. The solution should become clear.
1m
Pipette off the supernatant without disturbing the pelleted beads.
30s
Remove the tube from the magnet and add 250μL of Short Fragment Buffer (SFB). Resuspend the beads in the SFB by flicking the tube.
2m
Spin down for 3 seconds then return the tube to the magnet. Allow the beads to pellet, then remove the supernatant and discard.
30s
Repeat steps 10.6 and 10.7 to complete two washes.
2m 30s
Spin down the tube for 3 seconds, place back on the magnet, then remove any remaining SFB with a small volume, fine pipette tip.
30s
Allow the pellet to air dry for 1 minute.
1m
Take the tube off the magnet and add 15μL of Elution buffer (EB). Flick gently to resuspend the beads and incubate at room temperature for 10 minutes. Flick again a few times during the incubation to ensure sufficient mixing.
10m 30s
Spin down the tube for 3 seconds then place back on the magnet, allowing the beads to pellet completely.
1m
Remove 12µl of the eluted DNA and transfer to a clean 1.5mL tube or 200µL PCR tube.
Note
It is recommended to load the library for sequencing as soon as possible, but it can be stored overnight in the fridge or frozen for up to two weeks if storage is unavoidable.
30s
Priming and Loading of the MinION Flowcell
Thaw the Sequencing buffer (SB), Library beads (LIB), Flow Cell Tether (FCT), Bovine Serum Albumin (BSA) and the Flow Cell Flush (FCF) buffer at room temperature then place on ice.
Mix the SB, FCF, and FCT by vortexing, spin down, and return to ice. Spin down the LIB then place back on ice.
10m
Prepare the priming mix by adding the following reagents in a clean 1.5mL tube :
A
B
Reagent
Volume (μL)
Flow cell flush (FCF)
1,170
Flow cell tether (FCT)
30
BSA (50mg/ml)
5
Flowcell priming mix
Mix by pipetting, spin down briefly and store on ice until ready to use.
2m
Take the flow cell out from the sequencing device used for flow cell check and place it back in the plastic case.
Flow cell layout
Slide the flow cell's priming port cover clockwise so that the priming port is visible. After opening the priming port, check for any bubbles under the cover. Using an unlocked P1000 pipette and tip draw back a small volume to remove any bubbles (a few µLs). Visually check that there is continuous buffer from the priming port across the sensor array.
3m
Using a P1000 pipette, slowly load 800μL of the priming mix into the flow cell via the priming port.
Leave a small amount of liquid in the end of the pipette tip to ensure you do not introduce air into the flowcell.
Leave to incubate for 5 minutes.
6m
Prepare the library mix shown below by adding the Sequencing buffer (SB) and Library beads (LIB) to the tube containing your adapter ligated and cleaned library from step 10.13.
A
B
Reagent
Volume (μL)
DNA library
12
Sequencing buffer (SB)
37.5
Library beads (LIB)
25.5
Library mix, prepared for loading
2m
Complete the flowcell priming by opening the SpotOn port cover and carefully loading 200μL of the priming mix into the priming port. As before, leave a small amount of liquid in the bottom of the tip to avoid the introduction of air bubbles.
When adding the priming mix, you may see a small amount of liquid come up through the SpotOn port. If you do, pause and allow the liquid to flow back into the flowcell before continuing putting through the priming mix.
2m
Mix the prepared library mix gently by pipetting and load immediately.
Add the library mix to the flowcell via the SpotOn port in a dropwise fashion, allowing each drop to flow into the flowcell before adding the next.
2m
Replace the SpotOn port cover and close the priming port, then place the flowcell in your sequencing device.
1m
In the MinKNOW software follow the steps below to set up and start your sequencing run.
30s
Click start, then start sequencing.
Create a name for you sequencing run, it is good practise to make this unique and identifiable. The date and an experiment name are recommended. In sample name you can put a number or repeat the experiment name - this is not as important as the run name. Then click continue.
1m
Select the kit used - this is SQK-LSK114. Once you click this the barcoding options will appear. Select EXP-PBC096, then click continue
30s
In the run length options, set the run time depending on the number of pores you have from step 10.3.
a. 200 - 299 pores, set run time to 16 hours
b. 300 - 399 pores, set run time to 12 hours
c. >= 400 pores, set run time to 8 hours
30s
In the basecalling options, select high accuracy basecalling. In the barcoding options, make sure barcoding is enabled and toggle to use barcode at both ends. Double check your selected options, then click start run.
1m
Washing your flow cell
1h 23m 30s
After the sequencing run is finished you can wash your flow cell to remove the remaining library and either prepare for another sequencing run or for storage at 4 °C.
Thaw the Wash Diluent (DIL) at room temperature and mix briefly by vortexing. Spin down the tube of wash mix (WMX) and place on ice.
10m
Prepare the following wash solution in a clean 1.5ml tube:
Wash diluent
398μL
Wash mix
2μL
Flow cell wash solution
2m
Open the Priming port and using a P1000 pipette, carefully remove a small amount of liquid to remove any air bubbles under the port.
2m
Carefully add 200μL of the wash solution through the priming port, leaving a small amount of liquid in the tip at the end to avoid introducing an air bubble. Close the priming port and incubate for 5 minutes at room temperature.
6m
Add the remaining 200μL of wash solution through the priming port. Close the priming port and incubate at room temperature for one hour.
1h
At this point you can remove all waste from the waste channel, ensuring that the Priming Port is closed before doing so.
30s
You can also put a label on the packaging of the flow cell to detail the date it was run, what was run on it, for how long and which barcodes were used if not all 96. The results of the last pore count shown in the MinKNOW run report of the run can also be written on the label.
2m
If you will be storing the flow cell for future reuse, take out the bottle of Storage Buffer from the Wash Kit to thaw at room temperature.
After incubation you can either run a new library following the flow cell priming and loading steps starting from Step 11
Proceed with the putting the Storage buffer on for storing the flow cell for future use.
Briefly vortex the thawed Storage Buffer to mix, then add 500μL slowly through the Priming Port.
1m
Close the priming port before removing all waste from the waste channel. Place the flow cell back in its plastic box and envelope, then store at 4°C
Protocol references
Klapsa D, Wilton T, Zealand A, Bujaki E, Saxentoff E, Troman C, Shaw AG, Tedcastle A, Majumdar M, Mate R, Akello JO, Huseynov S, Zeb A, Zambon M, Bell A, Hagan J, Wade MJ, Ramsay M, Grassly NC, Saliba V, Martin J. Sustained detection of type 2 poliovirus in London sewage between February and July, 2022, by enhanced environmental surveillance. Lancet. 2022 Oct 29;400(10362):1531-1538. doi: 10.1016/S0140-6736(22)01804-9. Epub 2022 Oct 13. PMID: 36243024; PMCID: PMC9627700.
Shaw AG, Majumdar M, Troman C, O'Toole Á, Benny B, Abraham D, Praharaj I, Kang G, Sharif S, Alam MM, Shaukat S, Angez M, Khurshid A, Mahmood N, Arshad Y, Rehman L, Mujtaba G, Akthar R, Salman M, Klapsa D, Hajarha Y, Asghar H, Bandyopadhyay A, Rambaut A, Martin J, Grassly N. Rapid and Sensitive Direct Detection and Identification of Poliovirus from Stool and Environmental Surveillance Samples by Use of Nanopore Sequencing. J Clin Microbiol. 2020 Aug 24;58(9):e00920-20. doi: 10.1128/JCM.00920-20. PMID: 32611795; PMCID: PMC7448630.