May 07, 2026

Direct Detection of poliovirus and Nanopore Sequencing (DDNS) - Stool V.8

  • 1Imperial College London;
  • 2MHRA;
  • 3National Institute for Biological Standards and Control;
  • 4University of Edinburgh;
  • 5National Institute of Health Islamabad, Pakistan
  • Poliovirus Sequencing Consortium
Icon indicating open access to content
QR code linking to this content
Protocol CitationAlex Shaw, Catherine Troman, Joyce Akello, Erika Bujaki, Manasi Majumdar, Shannon Fitz, Ben Bellekom, Aine OToole, c.ansley , Rachel Colquhoun, YASIR ARSHAD, khurshida , alammu , Andrew Rambaut, Javier Martin, Nick Grassly 2026. Direct Detection of poliovirus and Nanopore Sequencing (DDNS) - Stool. protocols.io https://dx.doi.org/10.17504/protocols.io.rm7vzbyyxvx1/v8Version created by Jasmaine Lee
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 23, 2026
Last Modified: May 07, 2026
Protocol  Integer ID: 315628
Keywords: nanopore sequencing, oxford nanopore v14 chemistry ligation, use with oxford nanopore v14 chemistry ligation, polio specific primer, direct detection of poliovirus, vp1 region of poliovirus, identification of poliovirus, poliovirus, sequencing reagent, oxford nanopore, journal of clinical microbiology, sequencing, clinical microbiology, gridion sequencer, specific primer, pcr, ddn, polio, stool this protocol, minion mk1b, sensitive direct detection, minion mk1d
Funders Acknowledgements:
Bill and Melinda Gates Foundation
Abstract
This protocol is an update from the protocol described in the paper "Rapid and sensitive direct detection and identification of poliovirus from stool and environmental surveillance samples using nanopore sequencing" by Shaw et al in the Journal of Clinical Microbiology (2020), DOI: 10.1128/JCM.00920-20 and is commonly known as Direct Detection of Poliovirus by Nanopore Sequencing (DDNS).

The protocol aims to amplify the VP1 region of poliovirus through a semi-nested PCR using a pan-Enterovirus primer and polio specific primers followed by amplification of the VP1 region using a polio specific primer set. We use barcoded primers as this greatly simplifies the subsequent library preparation process. Within the protocol steps quality control checks are included. Following the QC steps as you go ensures the validity of your results and provides easier troubleshooting when needed.

This protocol is for use with Oxford Nanopore v14 chemistry ligation sequencing reagents and can be used with the MinION Mk1B, MinION Mk1D, or GridION sequencer.


Guidelines
Steps 13 onwards are based on the Ligation Sequencing of Amplicons protocol from Oxford Nanopore Technologies.

If you have a Tapestation or similar in your lab, you may use this instead of running gels for the quality control steps.
Materials
Download Equipment_Reagents_for_DDNS.xlsxEquipment_Reagents_for_DDNS.xlsx12.8KB

SuperScript III One-Step RT-PCR System with Platinum TaqInvitrogen - Thermo FisherCatalog #12457-026
DreamTaq PCR Master Mix (2X)Thermo FisherCatalog #K1071
NEBNext Ultra II End Repair/dA-Tailing Module - 24 rxnsNew England BiolabsCatalog #E7546S NEBNext Quick Ligation Module - 20 rxnsNew England BiolabsCatalog #E6056S Ligation Sequencing Kit V14Oxford Nanopore TechnologiesCatalog #SQK-LSK114 Ethanol, Absolute, Molecular Biology GradeThermo Fisher ScientificCatalog #BP2818500
0.2ml PCR tubes
1.5 mL LoBind tubes EppendorfCatalog #022431021
UltraPure™ DNase/RNase-Free Distilled WaterThermo Fisher ScientificCatalog #10977023
Ultrapure BSAAmbionCatalog #AM2616
Agencourt AMPure XPBeckman CoulterCatalog #A63880
Nanopore Flow Cell R10.4.1Oxford Nanopore TechnologiesCatalog #FLO-MIN114
ONT Flow Cell Wash KitOxford Nanopore TechnologiesCatalog #EXP-WSH004


Protocol materials
1.5 mL LoBind tubes EppendorfCatalog #022431021
UltraPure™ DNase/RNase-Free Distilled WaterThermo Fisher ScientificCatalog #10977023
Ultrapure BSAAmbionCatalog #AM2616
SuperScript III One-Step RT-PCR System with Platinum TaqInvitrogen - Thermo FisherCatalog #12457-026
Nanopore Flow Cell R10.4.1Oxford Nanopore TechnologiesCatalog #FLO-MIN114
ONT Flow Cell Wash KitOxford Nanopore TechnologiesCatalog #EXP-WSH004
DreamTaq PCR Master Mix (2X)Thermo FisherCatalog #K1071
NEBNext Ultra II End Repair/dA-Tailing Module - 24 rxnsNew England BiolabsCatalog #E7546S
NEBNext Quick Ligation Module - 20 rxnsNew England BiolabsCatalog #E6056S
Ligation Sequencing Kit V14Oxford Nanopore TechnologiesCatalog #SQK-LSK114
Agencourt AMPure XPBeckman CoulterCatalog #A63880
Ethanol, Absolute, Molecular Biology GradeThermo Fisher ScientificCatalog #BP2818500
Before start
RNA extraction
This protocol describes the amplification of the VP1 region, sample barcoding and library preparation. We anticipate users will have performed an RNA extraction prior to this protocol to extract Poliovirus RNA. We recommend the MagMAX Viral RNA Isolation Kit used either manually or carried out on the KingFisher Duo or Flex.

Barcoded VP1 Primers:
To allow a simplified protocol, we use a 96-well primer plate with 5µM barcoded Y7 primer and 5µM barcoded Q8 primer in each well.
Each well contains Q8 and Y7 primers with the same unique barcode e.g A1 = Y7 with barcode 1 and Q8 with barcode 1, A2 = Y7 with barcode 2 and Q8 with barcode 2, etc.

The full set of 96 barcoded primer sequences are shown in Dataset_S1 of Shaw et al, 2020 and in the attached spreadsheet. Download BarcodedPrimers.xlsxBarcodedPrimers.xlsx20KB

Lab cleaning
Before starting the process, it is essential that you decontaminate all surfaces and equipment, such as pipettes, to avoid contamination of your PCR reactions or sequencing library.

For decontaminating where you set up the RT-PCR, you can use a specific cleaning agent, such as RNAse Zap (AM9782, Invitrogen), in combination with 70% ethanol.

When setting up the PCR nest and sequencing library, you can wipe surfaces and pipettes with a DNA specific agent, such as DNA Zap (AM9890, Invitrogen), and 70% ethanol.

Sample Organisation
30m
Pairs of samples (with the same EPID) can have consecutive barcodes but try not to group samples from the same geographic area together. This helps detect any potential cross-contamination because identical sequences are then unlikely to be detected in samples with consecutive barcodes that are adjacent to one another on the 96-well plate.
Record sample data, and the order for the samples in a csv file. At this point you can also add any other metadata that you have such as the EPID, country of origin, date of sample collection and receipt, and date of RNA extraction.

Here is a template csv file:Download samples_csv_template_v2.csvsamples_csv_template_v2.csv
It is advised that you edit the name of the file so it is unique for each run you analyse. If you edit any column headers in the csv, do not use any spaces or special characters in the column header.

You should also include any positive and negative controls in your list of samples. A positive control (resuspended Coxsackievirus A20 provided by MHRA) and negative control (nuclease free water) should each be included on the first and last RNA extraction batches of the day at least. The positive control should be called "positive_[date of reconstitution]_[candidate]" in the sample column. The negative control should be called "negative" in the sample column. If there are multiple positive or negative controls, these can be defined by adding an underscore and a number.

If any samples are repeats from a previous run, note this down in the "IsQCRetest" column and note down the original run number in the column "IfRetestOriginalRun.


Note
Do not include any personal information from the patients in your csv file, and avoid using special characters in any of the metadata columns, including the sample names (stick to - or _)


30m
First Round PCR (semi-nest)
5h 40m
Wipe down lab bench surfaces and pipettes with 70% ethanol and an RNAse specific cleaning agent, such as RNAse Zap.
Prepare a master mix using the reaction volumes detailed in the table below for the number of samples you have plus negative controls. The reaction mix and SSIII enzyme are provided in SuperScript III One-Step RT-PCR System with Platinum TaqInvitrogen - Thermo FisherCatalog #12457-026


Forward primer: Y7 [GGGTTTGTGTCAGCCTGTAATGA]

Reverse Primers: Cre [TCAATACGGTGTTTGCTCTTGAACTG] (Arita et al. 2015)
nOPV-MM-R [TCGATACGGTGCTTGGATTTAAATTG]

Note
The reverse primers include both a Pan-enterovirus primer and a primer which allows amplification of nOPV2. These are mixed to make a working solution with each primer at 10μM .

For example, 10μL of each 100μM reverse primer stock is added to 80μL of nuclease free water to create 100μL of a working solution with each primer at 10μM

AB
Reagent1 reaction (μL)
2x Reaction mix12.5
SSIII Platinum Taq mix1
Reverse primers1
Nuclease free water4.5
Table1: Mastermix contents for a single first round PCR reaction. This can be multiplied up to fit the number of reactions you will be carrying out.

20m
Vortex the mastermix for 3 seconds and spin down for 5 seconds to gather contents at the bottom of the tube. Aliquot 19μL to each PCR tube and add 5μL of sample RNA or nuclease free water for negative controls.
10m
Incubate in a thermocycler for 30 minutes at 50°C.
30m
Add 1μL of the forward primer to each reaction.
5m
Amplify using the following cycling conditions:

ABCD
CycleStepTemperature (°C)Time
1Initial denaturation942 minutes
42Denaturation9415 seconds
Annealing5530 seconds
Extension682 minutes 30 seconds
1Final extension685 minutes
-Hold10-
Table 2: Cycling conditions for the first round PCR

Note
The DDNS method was validated on Eppendorf Nexus and Applied Biosystems ProFlex thermal cyclers. Thermal cyclers of other models and manufacturers might need adjustments in their settings, including the temperature ramp rate, to achieve sufficient amplification.


3h 20m
Once the PCR is finished, check to see if any reactions have evaporated, if so note this down in the sample csv.

Input into your csv the date that the first round PCR was carried out.
5m
Second Round PCR (VP1 amplification)
5h 10m
Wipe down all lab bench surfaces and pipettes with 70% ethanol and a DNA specific cleaning agent, such as DNA Zap.
Second Round PCR (VP1 amplification)
5h 10m
VP1 amplification is performed using barcoded primers as described in Dataset_S1 in Shaw et al 2020. These should be ordered in a 96-well plate layout and the forward and reverse primers premixed to a concentration of 5 μM working stock of each primer.

Prepare a mastermix as described below using DreamTaq PCR Master Mix (2X)Thermo FisherCatalog #K1071 and multiplying up for the number of reactions required:

AB
Reagent1 Reaction (μL)
DreamTaq 2x mastermix12.5
Nuclease free water8.5
Table 3: Mastermix contents for second round PCR using barcoded primers.

30m
Vortex the mastermix for 3 seconds and spin down for 5 seconds to gather contents at the bottom of the tube.
10s
Aliquot 21μL for each well of a 96-well PCR plate and add 2μL of premixed barcoded primers (comprising 5 μM of a forward primer and 5 μM of a reverse primer with the same barcode), ensuring a different barcode is used for each sample. Add 2μL of first round PCR product or nuclease free water for PCR negative controls.
10m
Amplify using the following cycling conditions:


ABCD
CycleStepTemp (C)Time
1Initial Denaturation952 minutes
35Denaturation9530 seconds
Annealing5530 seconds
Extension721 minute
1Final Extension7210 minutes
-Hold10
Table 4: Cycling conditions for VP1 PCR

2h
Once the PCR is finished, check to see if any reactions have evaporated, if so note this down in the sample csv.

Input into your csv the date that the VP1 PCR was carried out.
Check all positive and negative controls from both first and second round PCR on a 1% agarose gel.

All samples can be marked as “Pass” for the PositiveControlCheck in the barcodes csv if all positive controls extracted on the same day show a VP1 band on the gel. The expected VP1 band is around 1.2kb.

All samples can be marked as “Pass” for the NegativeControlCheck if all negative controls extracted on the same day show no VP1 band on the gel.

If any positive controls fail, or any negative controls have a band, samples should be marked as "Fail".
1h
If the positive control check failed, check the gel for the positive control first round PCR product. The expected half-capsid band for first round PCR is around 3kb.

If there is a band in the positive control, discard the VP1 amplicons and repeat the second round VP1 PCR.
If there is no band, repeat the first and second round PCR.

If there is no band visible after repeating the VP1 reaction, repeat the RNA extractions after checking the RNA extraction kit is being used correctly and has not expired.
1h
If the negative control check is failed, identify which step contamination was introduced and repeat from that step.

If there is a band in the extraction negative control, repeat from the RNA extraction step.
If there is a band in the first round PCR negative control, repeat from the first round PCR step (Step 2).
If there is a band in the second round PCR negative control, repeat from the second round PCR step (Step 8).

If the negative control still shows a band on a gel or tapestation:
  1. Thoroughly clean the PCR and RNA extraction workstations.
  2. Replace each of the First Round and VP1 reagents in turn whilst performing blank reactions to determine a contaminated reagent.
  3. Perform an additional Negative RNA extraction to confirm that that RNA extraction kit is not contaminated.


Note
To avoid cross contamination due to contaminated lab surfaces/equipment, we recommend giving the PCR and RNA workstations a thorough clean every 5 runs.

30m
Library Preparation for ONT MinION: Pooling, End-prep, and Adapter ligation
1h 45m
Pool 2μL of each VP1 PCR product into a 1.5mL tube and concentrate with AMPure beads
Agencourt AMPure XPBeckman CoulterCatalog #A63880

5m
Add a volume of AMPure beads equal to the volume of the pooled VP1 products and incubate at room temperature for 5 minutes. Flick gently after 2 minutes to aid binding.

e.g. 50 samples, 2µl each pooled = 100µl pool, so add 100ul AMPure beads
6m
Spin down the tube for 3 seconds then place on a magnetic rack until all the beads have formed a pellet and the solution is clear.


3m
Pipette off the solution, avoiding disturbing the bead pellet.
1m
Add 200μL of 80% Ethanol to the tube, leave for 30 seconds, then remove and discard.

Repeat.
2m
Spin down the tube for 2 seconds, place back on the magnet, then remove any remaining Ethanol.

Allow the pellet to air dry for 30 seconds or until dry but not cracking
1m
Take the tube off the magnet and add 51μL of nuclease free water. Flick the tube to resuspend the beads and incubate at room temperature for 2 minutes.
3m
Spin down the tube for 3 seconds then place back on the magnet, allowing the beads to pellet completely.
30s
Remove 50μL of the eluted DNA and add to a clean 0.2mL PCR tube.
30s
End-preparation:
Add the following reagents from NEBNext Ultra II End Repair/dA-Tailing Module - 24 rxnsNew England BiolabsCatalog #E7546S to the 0.2mL tube containing the cleaned DNA pool.

AB
ComponentVolume (μL)
UltraII End-prep reaction buffer7
UltraII End-prep enzyme mix3
Table 5: Reaction for end-prep of your pooled library

2m
Mix gently by flicking the tube and spin down for 3 seconds.
1m
In the thermocyler, incubate for 5 minutes at 20°C followed by 5 minutes at 65°C
10m
Transfer to a 1.5mL tube and perform an AMPure bead clean.
15m
Vortex the AMPure beads until all the beads are well mixed.
30s
Add 60μl of resuspended beads to the tube and flick the tube to mix.

Incubate at room temperature for 5 minutes. Flick gently after 2 minutes to aid binding.
5m
Spin down the tube for 3 seconds then place on a magnetic rack until all the beads have formed a pellet and the solution is clear.


1m
Pipette off the solution, avoiding disturbing the bead pellet.
1m
Add 200μL of 80% Ethanol to the tube, leave for 30seconds, then remove and discard.

Repeat.
2m
Spin down the tube for 2 seconds, place back on the magnet, then remove any remaining Ethanol.

Allow the pellet to air dry for 1 minute or until dry but not cracking
2m
Take the tube off the magnet and add 61μL of nuclease free water. Flick the tube to resuspend the beads and incubate at room temperature for 2 minutes.
3m
Spin down the tube for 3 seconds then place back on the magnet, allowing the beads to pellet completely.
1m
Remove 60μL of the eluted DNA and add to a clean 1.5mL tube.
Note
At this point you can store the end-prepared library at 4°C. This can be stored up to one week before continuing to step 18, however it is advised to continue the library preparation protocol as soon as possible.

Ensure you label the tube clearly with the run name and what stage of the library preparation you were at e.g. 20240229 DDNSrun10 end-prep

30s
From NEBNext Quick Ligation Module - 20 rxnsNew England BiolabsCatalog #E6056S :
Spin down the NEB Quick T4 Ligase and place on ice

From Ligation Sequencing Kit V14Oxford Nanopore TechnologiesCatalog #SQK-LSK114 :
Spin down and thaw Ligation Adapter (LA) on ice.
Thaw Ligation Buffer (LNB) at room temperature, spin down, mix by pipetting, then place on ice.
Thaw Elution Buffer (EB), and Short Fragment Buffer (SFB) at room temperature, mix by vortexing then place on ice.

If you plan to start the run on the same day, remove the flow cell flush (FCF), flush tether (FLT) and BSA from the freezer and thaw at room temperature. Once thawed, place on ice.

Remove your flow cell (FLO-MIN114, R10.4.1) from the fridge to allow it to get to room temperature.

3m
Prepare the following reaction mix adding reagents to the 1.5mL tube with end-prepped DNA:

AB
ComponentVolume (μL)
End-prepped DNA60
Ligation buffer (LNB)25
Quick T4 Ligase10
Ligation Adapter (LA)5
Table6: Reaction mix for sequencing adapter ligation

2m
Mix gently by flicking the tube then spin down.
1m
Incubate at room temperature for 10 minutes.
10m
During this time, you can run your flow cell check

Plug in your sequencing device, open the lid and insert your flowcell. In the MinKNOW software, navigate to the start panel then select flowcell check, then start. This will tell you how many pores are available for sequencing.
If your flow cell has been used before, instead of running a flow cell check, start a dummy sequencing run by selecting Start Sequencing, name the run "flowcell_check", select any kit, then set the time to 0.2 hours, then start the run. At the beginning of the run it will do a short flow cell check and give a more accurate number for the available pores (calculated by adding together the available and unavailable pores in the pore status graph (see example image below)).



If a flow cell has less than 200 pores, do not use it for a DDNS run. Take out a different flow cell and perform a flow cell check.
The number of pores available in the flow cell you use for sequencing should be noted down in the sample csv in the column “PoresAvilableAtFlowCellCheck” and the flow cell ID should be recorded in the “FlowCellID” column. Also record the number of times the flow cell has been used previously in the column “FlowCellUses”.
Carry out an AMPure bead purification using 40μL of resuspended AMPure XP beads.

Note: This clean-up is different to previous as it uses the ONT Short Fragment Buffer (SFB) and Elution buffer (EB) instead of 80% ethanol and water.
Vortex the AMPure beads until all the beads are well mixed.
30s
Add 40μL of resuspended beads to the 1.5mL tube and mix by flicking the tube.

Incubate at room temperature for 5 minutes. Flick gently after 2 minutes to aid binding.
6m
Spin down the tube for 3 seconds then place on a magnetic rack until all the beads have formed a pellet and the solution is clear.
1m
Pipette off the solution, avoiding disturbing the bead pellet.
30s
Add 250μL of Short Fragment Buffer (SFB). Remove the tube from the magnet and resuspend the beads in the SFB by flicking the tube.
Spin down for 3 seconds then return the tube to the magnet.
Allow the beads to pellet, then remove and discard.

Repeat.
4m
Spin down the tube for 2 seconds, place back on the magnet, then remove any remaining SFB.

Allow the pellet to air dry for 1 minute or until dry but not cracked
1m
Take the tube off the magnet and add 15μL of Elution buffer (EB). Flick gently to resuspend the beads and incubate at room temperature for 10 minutes.
10m
Spin down the tube for 3 seconds then place back on the magnet, allowing the beads to pellet completely.
1m
Remove 12µl of the eluted DNA and transfer to a clean 1.5ml tube.
Note
At this point you can keep your prepared library at 4°C overnight with minimal loss of throughput. This can be kept for up to two weeks before sequencing, however we recommend that you continue to flow cell loading as soon as possible.

Ensure you label the tube clearly with the run name and what stage of the library preparation you were at e.g. 20240229 DDNSrun10 final library

30s
Priming and Loading of the MinION Flowcell
30m
Thaw the Sequencing buffer (SB), Library beads (LIB), Flow Cell Tether (FCT) and one tube of Flow Cell Flush (FCF) at room temperature then place on ice.

Mix the SB, FCF, and FCT by vortexing, spin down, and return to ice. Spin down the LIB then place back on ice.
10m
To create the priming mix the following reagents in a clean 1.5ml tube:


AB
ReagentVolume (μL)
Flow cell flush (FCF)1,170
Flow cell tether (FCT)30
BSA (50mg/ml)5

Mix by pipetting and spin down. Place on ice until ready to use.

2m
Open the lid of the nanopore sequencing device and slide the flow cell's priming port cover clockwise so that the priming port is visible. After opening the priming port, check for any bubbles under the cover. Draw back a small volume to remove any bubbles (a few µLs). Visually check that there is continuous buffer from the priming port across the sensor array.
3m
Using a P1000 pipette, slowly load 800μL of the priming mix into the flow cell via the priming port.

Leave a small amount of liquid in the end of the pipette tip to ensure you do not introduce air into the flowcell.

Leave for 5 minutes.
2m
Mix the contents of the LIB tube by pipetting just before adding to the following library mix in a 1.5ml tube:


AB
ReagentVolume (μL)
DNA library12
Sequencing buffer (SB)37.5
Library beads (LIB)25.5

2m
Complete the flowcell priming by opening the SpotOn port cover and carefully loading 200μL of the priming mix into the priming port. As before, leave a small amount of liquid in the bottom of the tip to avoid the introduction of air bubbles.

When adding the priming mix, you may see a small amount of liquid come up through the SpotOn port. If you do, pause and allow the liquid to flow back into the flowcell before continuing putting through the priming mix.
2m
Mix the prepared library mix gently by pipetting.

Add the library mix to the flowcell via the SpotOn port in a dropwise fashion, allowing each drop to flow into the flowcell before adding the next.
2m
Replace the SpotOn port cover and close the priming port, then replace the lid of your sequencing device.
1m
In the MinKNOW software follow the steps below to set up and start your sequencing run.

30s
Click start, then start sequencing.
Create a name for you sequencing run, it is good practise to make this unique and identifiable for if you ever need to revisit the data. The date and an experiment name are recommended. In sample name you can put a number or repeat the experiment name - this is not as important as the run name. Then click continue.
1m
Select the kit used - this is SQK-LSK114. Once you click this the barcoding options will appear. Select EXP-PBC096, then click continue
30s
In the run length options, set the run time depending on the number of pores you have from step 23.1.

a. 200 - 299 pores, set run time to 8 hours
b. 300 - 399 pores, set run time to 6 hours
c. >= 400 pores, set run time to 4 hours
30s
In the basecalling options, select high accuracy basecalling. In the barcoding options, make sure barcoding is enabled and toggle to use barcode at both ends. Double check your selected options, then click start run.
1m
In your sample csv, record the run number in the column "RunNumber", the date in "DateSeqRunLoaded", and the run duration in "RunHoursDuration".
2m
Washing your flow cell
1h 23m
After the sequencing run is finished, if the flow cell has >= 200 pores remaining, you can wash your flow cell to remove the remaining library and either prepare for another sequencing run or for storage at 4 °C . The wash uses the reagents supplied in the ONT wash kit: ONT Flow Cell Wash KitOxford Nanopore TechnologiesCatalog #EXP-WSH004

Thaw the Wash Diluent at room temperature and mix briefly by vortexing.

Spin down the tube of wash mix (WMX) and place on ice.
10m
Prepare the following wash solution in a clean 1.5ml tube


AB
Wash diluent398μL
Wash mix2μL

5m
Open the Priming port and using a P1000 pipette, carefully remove a small amount of liquid to remove any air bubbles under the port.
2m
Carefully add 200μL of the wash solution through the priming port, leaving a small amount of liquid in the tip towards the end to avoid introducing an air bubble. Close the priming port and incubate for 5 minutes at room temperature.
1m
Add the remaining 200μL of wash solution through the priming port. Close the priming port and incubate at room temperature for one hour.

At this point you can remove all waste from the waste channel, ensuring that the Priming Port is closed before doing so.

You can also put a label on the packaging of the flow cell to detail the date it was run, what was run on it, length of sequencing run and number of pores remaining at the end of the run.
e.g. 13/03/2024 DDNS-run30 4 hours 908 pores remaining

If you will be storing the flow cell for future reuse, take out the bottle of Storage Buffer from the Wash Kit to thaw at room temperature.
1h
After incubation you can either follow the flow cell priming and loading steps starting from Step 23 to load a new run, or the following steps for storing the flow cell for future use.

Briefly vortex the thawed Storage Buffer to mix, then add 500μL slowly through the Priming Port.

Close the priming port before removing all waste from the waste channel. Place the flow cell back in its plastic box and envelope, then store at 4°C

5m