Oct 27, 2022

Determining MLST allele sequences in novel STs

  • 1Central Research Laboratory, Kempegowda Institute of Medical Sciences, Bengaluru, India
Icon indicating open access to content
QR code linking to this content
Document CitationVarun Shamanna 2022. Determining MLST allele sequences in novel STs. protocols.io https://dx.doi.org/10.17504/protocols.io.36wgqj7kovk5/v1
License: This is an open access document distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Created: October 27, 2022
Last Modified: October 27, 2022
Document Integer ID: 71866
Keywords: mlst allele sequences in novel sts step, novel allele sequence of mlst, determining mlst allele sequence, novel allele sequence, mlst, novel sts step, assembly file
Abstract
Steps required to determine Novel allele sequence of MLST from the assembly files using MLSTaR R package
GHRU Determining MLST allele sequences in novel STs
There are many methods both manual and programmatic for achieving this. Here is just one method using an existing software tool - MLSTar (https://github.com/iferres/MLSTar)

  1. First install the blast dependency. It is recommended to perform this using a conda package conda install -c bioconda blast
  2. MLSTar is an R package so install R if not already installed (RStudio recommended). Then within the console in R/RStudio
  3. Install the devtools package install.packages("devtools")
  4. Install the MLSTar package devtools::install_github('iferres/MLSTar')
  5. This package will only work "out of the box" with MLST schemes on the PubMLST database/website, so for other schemes (e.g Klebsiella on the Pasteur website) you need to download the profiles and allele sequences. For klebsiella the profiles can be found https://bigsdb.web.pasteur.fr/cgi-bin/bigsdb/bigsdb.pl?db=pubmlst_klebsiella_seqdef allele sequences can be found here https://bigsdb.web.pasteur.fr/cgi-bin/bigsdb/bigsdb.pl?db=pubmlst_klebsiella_seqdef&page=downloadAlleles I have pre-downloaded them and zipped them up here
Please noteIf providing your own profiles and sequences check that the header names in the profiles TSV match the names of the sequence file prefixes and that there are no trailing tabs in either the header or profile rows. e.g sed -i 's/[[:space:]]*$//' kpn_profiles.txt

on Mac OSX
sed -i '' 's/[[:space:]]*$//' kpn_profiles.txt
  1. Then to find the profiles and extract the sequences we run the following commands
  2. Find supported organisms listPubmlst_orgs()
  3. Find schemes for a supported organism listPubmlst_schemes(org = "escherichia") There are many schemes including some very long ones which are the cgMLST schemes, however you will see 2 familiar ones for E.coli $scheme_1
[1] "adk" "fumC" "gyrB" "icd" "mdh" "purA" "recA"
attr(,"Desc")
[1] "MLST (Achtman)" $scheme_2
[1] "dinB" "icdA" "pabB" "polB" "putP" "trpA" "trpB" "uidA"
attr(,"Desc")
[1] "MLST (Pasteur)"

  1. To call MLST and write alleles to a file results <- doMLST( c("G18000002.fasta", "G18000051.fasta"), org = "escherichia", scheme = 1, write = "all") results$result
adk fumC gyrB icd mdh purA recA ST
G18000002 92 4 87 96 70 58 2 648
G18000051 53 40 47 13 36 28 29 131
  1. The allele sequences are found in a directory as shown below. In this case there are no new alleles and so there is no need to examine these on the linux terminal (not R console) ls -l alleles_escherichia_1/
total 28
-rw-rw-r-- 1 biouser biouser 1196 Nov 2 11:07 adk.fasta
-rw-rw-r-- 1 biouser biouser 1061 Nov 2 11:07 fumC.fasta
-rw-rw-r-- 1 biouser biouser 1044 Nov 2 11:07 gyrB.fasta
-rw-rw-r-- 1 biouser biouser 1160 Nov 2 11:07 icd.fasta
-rw-rw-r-- 1 biouser biouser 1026 Nov 2 11:07 mdh.fasta
-rw-rw-r-- 1 biouser biouser 1081 Nov 2 11:07 purA.fasta
-rw-rw-r-- 1 biouser biouser 1145 Nov 2 11:07 recA.fasta

  1. For other schemes the paths to the profiles and allele sequences need to be provided (in this case they are in a directory called mlst_scheme) and you'll need to provide a dummy organism e.g test since "klebsiella" is not an officially supported organism results <- doMLST( c("G18583057.fasta", "G18583075.fasta"), org = "test", scheme = 1, schemeFastas = c(
"mlst_scheme/gapA.fas",
"mlst_scheme/infB.fas",
"mlst_scheme/mdh.fas",
"mlst_scheme/pgi.fas",
"mlst_scheme/phoE.fas",
"mlst_scheme/rpoB.fas",
"mlst_scheme/tonB.fas"),
schemeProfile = "mlst_scheme/kpn_profiles.txt",
write = "all")
When looking at the result this time you will see that the profiles have an unknown allele 'u1' results$result
gapA infB mdh pgi phoE rpoB tonB ST
G18583057 2 5 u1 1 4 1 4 NA
G18583075 2 5 u1 1 4 1 4 NA

Or

If you have novel profile instead of a unknown allele 'u1' the result will be a profile with all allele numbers assigned but ST still NA since the alleles present represent a new combination.
gapA infB mdh pgi phoE rpoB tonB ST
G18250048 3 3 1 1 1 1 4 NA


  1. The novel allele sequences can be found in the output file cat alleles_test_1/mdh.fasta
>mdh_u1;G18583057;NODE_2_length_734790_cov_17.426302
catcgacaaggtcgccgacccgccgcccgctttcgcttccacgacttcggtaccggcgtt
ctgaatacgtttagtcaggtcggcaatttcctgatcgctaaagctgacgccggggatctg
cgacagtaaaggcagaatggtgaccccggagtgaccaccaatgaccgggacttccacctc
ggttgccgatttacctttcagctccgccacaaaggtattggaacggatgatgtcaagcgt
ggtaacgccgaacagtttgtttttatcgtacacgccggcttttttcagtacttcggcggc
gatagccacggtggtattcaccgggttggtgataatgccgatgcaggcctgcgggcaggt
tttggcaatctgctgcacgaggttcttcacgatacccgcattcacattaaacaggtcgga
acgatccatgccgggcttacgcgccacgcccgcggagatcagcactacatccgcg
>mdh_u1;G18583075;NODE_2_length_734148_cov_16.523686
cgcggatgtagtgctgatctccgcgggcgtggcgcgtaagcccggcatggatcgttccga
cctgtttaatgtgaatgcgggtatcgtgaagaacctcgtgcagcagattgccaaaacctg
cccgcaggcctgcatcggcattatcaccaacccggtgaataccaccgtggctatcgccgc
cgaagtactgaaaaaagccggcgtgtacgataaaaacaaactgttcggcgttaccacgct
tgacatcatccgttccaatacctttgtggcggagctgaaaggtaaatcggcaaccgaggt
ggaagtcccggtcattggtggtcactccggggtcaccattctgcctttactgtcgcagat
ccccggcgtcagctttagcgatcaggaaattgccgacctgactaaacgtattcagaacgc
cggtaccgaagtcgtggaagcgaaagcgggcggcgggtcggcgaccttgtcgatg