Jan 08, 2022
Detection of Cryptosporidium in stool samples by Taq-Man qPCR
- botchiesenyo 1
- 1University of Ghana
- Ayi and Pawlowic Lab Collaborations
Protocol Citation: botchiesenyo 2022. Detection of Cryptosporidium in stool samples by Taq-Man qPCR. protocols.io https://dx.doi.org/10.17504/protocols.io.bwghpbt6
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working
Created: July 09, 2021
Last Modified: January 08, 2022
Protocol Integer ID: 51433
Keywords: cryptosporidium in stool sample, man qpcr detection of cryptosporidium parvum, cryptosporidium parvum, cryptosporidium, fecal samples by qpcr, fecal sample, stool sample, man qpcr detection, qpcr, taq
Abstract
Detection of Cryptosporidium parvum and/or Cryptosporidium hominis from fecal samples by qPCR.
Troubleshooting
Generating samples for a standard curve
25m
To 100 mg of fecal material (known to not be infected with Cryptosporidium), spike in a known number of Cryptosporidium parvum.
25m
DNA Extraction
2h 30m
Follow protocol from Quick-DNA Fecal/Soil Microbe Miniprep Kit from Zymo Research to extract total genomic DNA from stool sample (both standard curve samples and experimental samples).
Stool samples (0.1 g) should be thoroughly vortexed in lysis buffer and then subjected to five freeze-thaw cycles prior to DNA extraction.
2h 30m
qPCR
Combine the following for a single qPCR sample (9μl per sample). Scale accordingly for number of samples and technical replicates:
5 μl 10 x Luna Universal Probe qPCR Master Mix
0.25 μl 10 μM Forward Primer (ATGACGGGTAACGGGGAAT)
0.25 μl 10 μM Reverse Primer (CCAATTACAAAACCAAAAAGTCC)
1μl 1 μM Probe ([FAM]CGCGCCTGCTGCCTTCCTTAGATG[BHQ1])
2.5μl Ultrapure water
45m
Load mastermix in 96-well PCR plate using a multichannel pipette.
Add 1μl extracted DNA to corresponding wells.
Keep a detailed plate map of which wells contain standard curve DNA, sample DNA, positive control DNA, no DNA control.
1h
Spin plate in a centrifuge at low speed to make sure the samples are at the bottom of the well.
5m
Run qPCR cycling as described for Luna Universal qPCR Mixture. Make sure qPCR machine is measuring FAM at the correct cycle:
1h
95°C - 3 minutes
3m
Repeat 40x:
95°C - 10 seconds
60°C - 30 seconds (record FAM in this step)
57m
Calculating number of oocysts/g
2h
Calculate delta Ct values for samples that contain the standard curve.
Using Microsoft excel (or a similar graphing program) plot the delta Ct values on the Y-axis and the number of oocysts/g on the x-axis.
Use the analysis tools to determine the linear equation of your standard curve samples.
1h
Use the equation determined from your standard control samples, you can estimate the number of oocysts/g in your experimental samples.
Y = delta Ct value for experimental sample
Solve for X = oocysts/g for your experimental sample
1h