Jun 19, 2024

Detection of Bordetella pertussis and Bordetella parapertussis Using the ABI 7500 Real-time PCR System

  • Martin Cheung1,
  • Tracy Lee1,
  • Robert Azana1,
  • Loretta Janz1,
  • Natalie Prystajecky1,2,
  • Linda Hoang1,2
  • 1BCCDC Public Health Laboratory, Provincial Health Services Authority;
  • 2UBC Department of Pathology and Laboratory Medicine
Icon indicating open access to content
QR code linking to this content
Protocol CitationMartin Cheung, Tracy Lee, Robert Azana, Loretta Janz, Natalie Prystajecky, Linda Hoang 2024. Detection of Bordetella pertussis and Bordetella parapertussis Using the ABI 7500 Real-time PCR System . protocols.io https://dx.doi.org/10.17504/protocols.io.6qpvr863zlmk/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 03, 2024
Last Modified: June 19, 2024
Protocol  Integer ID: 99234
Keywords: pis1001 insertion sequence of the bordetella parapertussi, detection of bordetella pertussi, bordetella parapertussi, bordetella pertussi, qpcr, qualitative pcr, present in some strain, pcr, pis1001 insertion sequence, detection of the is481 insertion sequence, time pcr system, strain, most strain, time pcr system this procedure
Abstract
This procedure provides instructions for how to perform qualitative PCR (qPCR) for the detection of the IS481 insertion sequence of Bordetella pertussis and the pIS1001 insertion sequence of the Bordetella parapertussis from appropriate direct specimens. The IS481 insertion has been found to be present in some strains of B. bronchiseptica and most strains of B. holmesii. Some strains of B. bronchseptica also carry the pIS1001insertion sequence. The B. holmesii and B. bronchiseptica multiplex qPCR should be performed when indicated.
Guidelines
Perform all manipulations of samples and DNA in a genomic level PCR laboratory. Prepare PCR master mixes in a Reagent Preparation Clean Room.
Materials
Samples
Primary specimens:
I. Pernasal swab (2 is recommended and the specimen of choice)
II. nasal pharyngeal swab/wash/aspirate
III. post nasal swab

Referred Cultures:
Pure cultures of bacterial isolates on charcoal plates.

Reagents, Materials, and Equipment
ReagentsMaterialsEquipment
Life Technologies Fast Advanced master mix (#4444557)Microcentrifuge tubesBiological Safety Cabinet Class 2 Type A/B3
PCR grade waterABI 96-well optical plates Fully equipped reagent and genomic preparation clean rooms
IDTE 1x TE Buffer pH 8.0optical adhesive filmHeating Blocks
IS481 primers and probeadhesive filmPipettes (various volumes)
pIS1001 primers and probe adhesive film applicatorApplied Biosystems 7500 Real-time Analyzer
Human Beta Globin (HBG) primers and probepipette tips (various volumes)
Internal positive control gBlock and primers and probeLo-bind PCR tubes
Instagene Matrix (BioRad) tube racks
HBG-IS481-pIS1001 gBlockDiscard pail and waste bags
QC strain of Bordetella parapertussis organism disposable gloves and gown
Ambion Carrier RNA (thermofisher #4382878)Clear plastic bags

Primers
PrimersSequenceProduct SizeFinal Concentration (nM)TargetReference
PPertM_mod (481-F)CATCAAGCACCGCTTTACCC117300IS481Modified Kamachi et al., 2015
APPert_mod-R (481-R)TGTTGGGAGTTCTGGTAGGTGTG
135U17 (F) (1001-F)TCGAACGCGTGGAATGG65150pIS1001Tatti et al., 2011
199L20 (R) (1001-R)GGCCGTTGGCTTCAAATAGA
HBG-FACCCAGAGGTTCTTTGAGTCCTTT82100HBGMauritz et al.
HBG-RTGCCATGAGCCTTCACCTTAG

Probes
ProbeSequenceTargetDye/QuencherFinal Concentration (nM)Reference
871U22P_MGB (481-P)TTGCGTGAGTGGGCTIS481FAM/MGB150Modified Tatti et al., 2011
157U21P (1001-P)AGACCCAGGGCGCACGCTGTCpIS1001VIC/QSY150Tatti et al., 2011
HBG-PCACTCCTGATGCTGTTATGHBGNED/MGB100Modified Mauritz et al.
Pxd34_long (IPC-P)AATGCCTGCGACAGCTACTGCAACTTCAIPCCY5/TAO100In-house

Controls
Extraction ControlsControl Organism/ReagentComment
NEC: Negative Extraction ControlPCR grade waterNegative extraction control is used to test the sterility of the extraction reagents.
PEC: Positive Extraction ControlMaterial positive for Bordetella parapertussisPositive extraction control is used to test the effectiveness of the extraction protocol with the organisms of interest

PCR ControlsControl Organism/ReagentComment
HBG-IS481-pIS1001 gBlockFrozen aliquots of gBlock for HBG, B. pertussis, and B. parapertussis diluted to 2.46 x 10^2 copies/uLSee below for preparation and sequence
NTC: No Template ControlPCR grade waterUse the same lot of water as was used in the preparation of the master mix. Tests for the sterility of the master mix reagents.

Inhibition ControlControl Organism/ReagentComment
IPC: Internal Positive ControlIPC gBlock diluted to 1000 copies/ul and 1 uL added to each reactionIPC control is used to test for possible PCR inhibitors present in each patient sample. See below for preparation and sequence


gBlock Sequences

IPC gBlock (to be spiked into the master mix)
ATGAGCTGGGCATCAAGCACCGCTTTACCCGACCTTACCGCCCACAGACCAATGGGAGACAAGAATGGCGAGAAAATGCCTGCGACAGCTACTGCAACTTCAAGTTCGGAAGGCGGCTGCCACACCTACCAGAACTCCCAACACCGAGCCGATGCCATGAAATC

PCR gBlock = HBG-IS481-pIS1001 gBlock (to be used as positive PCR control)
TGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTCGCCGCGCTGTGCCATGAGCTGGGCATCAAGCACCGCTTTACCCGACCTTACCGCCCACAGACCAATGGCAAGGCCGAACGCTTCATCCAGTCGGCCTTGCGTGAGTGGGCTTACGCTCACACCTACCAGAACTCCCAACACCGAGCCGATGCCATGAAATCCTGGGGGAGGCTGGCAGGGCTATGGCGTCGAACGCGTGGAATGGCCCGAAGACCCAGGGCGCACGCTGTCGATCTATTTGAAGCCAACGGCCAAGGTGATGCTGTGCGAGCAGTGC

Reconstitute gBlocks as per the manufacturers instructions and dilute to desired concentration (copies/ul) using 1 part Carrier RNA to 5 parts IDTE buffer.

Note: dilutions of gBlock are best kept stored in 0.5 mL lo-bind PCR tubes at -20 °C

Safety warnings
Method Limitations:

1. The IS481 insertion element has been found to be present in some strains of B. bronchiseptica and most, if not all strains of B. holmesii.

2. Procedure for indications of when to run the PCR specific to B. holmesii.

3. The pIS1001 insertion sequence has been found in some strains of B. bronchiseptica.

4. The IPC uses the same primers as the IS481 amplicon, so a negative IPC signal when IS481 is positive is not indicative of inhibition.

Procedure A: Preparing 20X PCR Master Mix
All primer and probe sequences are listed in the materials section of this protocol.

Order all necessary primers and probes; if received lyophilized reconstitute as per the manufacturers instructions before making desired stock dilutions.
Turn on the Biological Safety Cabinet (BSC) in the Reagent Preparation Clean Room. Allow the BSC to stabilize, ensure it is functioning as expected, and decontaminate prior to using.

Inside the BSC, prepare 20X PERT Mix as per the following table. Prepare 1 mL total volume for each batch.

Primer/ProbeStock Concentration (uM)Final PCR Concentration (nM)(uL) for 1000 reactions
481-F10030060
481-R10030060
481-P10015030
1001-F10015030
1001-R10015030
1001-P10015030
HBG-F10010020
HBG-R10010020
HBG-P10010020
IPC-P10010020
IDTE Volume680
Final Volume1000

Pipette the 20X PERT mix into 100 µL aliquots. Label each aliquot with 20X PERT Mix.

Store 20X PERT aliquots in 4 °C fridge for short-term storage
and a -20 °C freezer inside a Reagent Preparation Clean Room for long-term storage.

Procedure B: Setting up the Real-Time PCR Reactions
Turn on the BSC in the Reagent Preparation Clean Room. Allow the BSC to stabilize, and decontaminate before use.
Remove an aliquot of 20X PERT Mix from the -20 °C freezer and allow to thaw.

Note: probes are light sensitive - store away from light.

Vortex the thawed 20X mix, then spin down quickly before use.
In a 1.7 mL microcentrifuge tube prepare the master mix cocktail as follows, ensuring all reagents are mixed thoroughly before pipetting into the 96-well plate.

Add the first 3 reagents in a Reagent Preparation Clean Room. The IPC gBlock is stored in the PCR Genomic Room and is added after transfer to that room.
Reagents1x reaction (uL)
PCR grade water3
Fast Advanced Master Mix10
20X PERT Mix1
IPC gBlock (1000 copies/uL) -added in genomics room-1

In a clear plastic bag, transfer the microcentrifuge tube with the first 3 ingredients of the master mix from the Reagent Preparation Clean Room to the PCR Genomic Room.

Remove the IPC gBlock and PCR gBlock controls from the -20 °C freezer to thaw.

See Materials section for gBlock sequences used.

When gBlocks are fully thawed vortex and spin down briefly.
Add the IPC gBlock to the master mix cocktail as per the recipe in step 20.
Vortex the master mix and briefly spin down.
Aliquot 15 µL of master mix into the required number of wells of a 96-well optical plate according to the plate map.

Order in rack and pipette in the following order:

1. Initial NTC: 5 µL of the same lot PCR grade water that was used to prepare the master mix.
2. Patient Samples and Additional NTCs:
  • 5 µL of each patient sample extract
  • 5 µL of additional NTCs of the same lot of PCR grade water that was used to prepare the master mix. Run approximately every 15th well.
3. PEC*: 5 µL of extract
4. HBG-IS481-pIS1001 gBlock: 5 µL
5. NEC*: 5 µL of extract


Note*: It is suggested to use a positive and negative extraction control as per individual laboratory practice. Please see "Controls" in the Materials section for more details on the PEC and NEC.
Apply an optical 96-well plate film to the plate using the plate seal applicator, taking care to seal the plate edges and avoid touching the top of the film.

Note: any fingerprints or residue on the film will alter the optical readings


IfThen
Plate will not be run immediately Store the plate in a 4C fridge until ready to perform PCR
Plate will be run immediately Proceed to load and run the plate on the ABI 7500

On the ABI 7500 instrument create a new experiment for the current run as per the ABI 7500 User Manual.

Check that the following cycling conditions are correctly programmed:


Temperature (°C)TimeNumber of Cycles
502 minHold
9520 secHold
953 sec40
6030 sec

Either input your samples and controls into the current run file manually or import the data from a saved run file on a memory stick.

Ensure all wells are assigned correctly on the run file as per the pipetting of the sample plate.
Check that each sample well has the correct target, dye, and quencher assigned to it.


TargetDyeQuencher
HBGNEDMGB
IPCCY5None
IS481FAMMGB
pIS1001VICNone

Load the plate onto the ABI 7500 instrument.
Save the run on the instrument and start the run as per the ABI 7500 user manual.
Procedure D: 7500 FAST Run Analysis
Ensure that the run has completed successfully. Click OK.

Select the Analysis tab after the run has completed, and then select the "Amplification Plot" tab.

To view all samples, click on the small square at the top left of the plate map to select all the wells on the plate at once. Curves should now appear on the graph.
Under "Options" (at the bottom of the screen) Select "IS481"
Unclick Auto threshold and enter a manual value of 0.1. Click "Auto Baseline".
Repeat steps 34 & 35 for targets "pIS1001", "HBG", and "IPC"
Click on the "Analyze" button.
Ensure that under "Plot Settings" the "Delta Rn vs. Cycle" option is selected and plot colour is set to "target".
View the results of all run controls and ensure they have produced acceptable values before proceeding with clinical sample analysis.
Clinical Samples:

Examine results for the HBG, IS481, pIS1001, and IPC targets for each clinical sample.

Note: All Ct values must be confirmed by viewing the amplification curve and multicomponent plot for appropriate graphing of positive result.

See the Applied Biosystems 7500 Fast Real-Time PCR System Presence/Absence Experiments manual at:




If Ct value for HBG is:Then value for analysis is:
Any Ct valuePositive
UndeterminedNegative

If Ct value for IS481 is:Then value for analysis is:
35 or lowerPositive for B. pertussis or B. holmesii*
greater than 35 and less than or equal to 40 Indeterminate
UndeterminedNegative
* Please see method limitation #1 in the Warning section.


If Ct value for pIS1001 is: Then value for analysis is:
35 or lowerPositive for B. parapertussis
greater than 35 and less than or equal to 40Indeterminate
UndeterminedNegative


If Ct value for IPC is:Then value for analysis is:
Any Ct valuePositive
UndeterminedNegative


Protocol references
1. Kamachi, K., Yoshino, S., Katsukawa, C., Otsuka, N., Hiramatsu, Y., & Shibayama, K. (2015). Laboratory-based surveillance of pertussis using multitarget real-time PCR in Japan: evidence for Bordetella pertussis infection in preteens and teens. New Microbes and New Infections, 70-74.

2. Tatti, K. M., Sparks, K. N., Boney, K. O., & Tondella, M. L. (2011). Novel Multitarget Real-Time PCR Assay for Rapid Detection of Bordetella Species in Clinical Specimens. Journal of Clinical Microbiology, 4059-4066.