Jun 02, 2026

Designing primers, probes and G-block

DOI
https://dx.doi.org/10.17504/protocols.io.bp2l6jz7rvqe/v1
  • Lea Caduff1,
  • Timothy R. Julian1,2,3,
  • Christoph Ort1
  • 1Eawag, Swiss Federal Institute of Aquatic Science and Technology, Dübendorf, Switzerland;
  • 2Wastewater Monitoring Laboratory;
  • 3Eawag Aquatic Research
  • WML Protocols
Nadja Widrig
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.bp2l6jz7rvqe/v1
Protocol Citation: Lea Caduff, Timothy R. Julian, Christoph Ort 2026. Designing primers, probes and G-block. protocols.io https://dx.doi.org/10.17504/protocols.io.bp2l6jz7rvqe/v1
Manuscript citation:
Protocol: Designing primers, probes and gblocks
Pathogens and Human Health Group
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 19, 2026
Last Modified: June 02, 2026
Protocol  Integer ID: 313596
Keywords: designing primer, primer, pcr experiment, gblock, primers ii, sequence of the primer, starting points of the polymerase, positive control within pcr experiment, reverse primer, dna fragment, stranded dna fragment, forward primer, polymerase, called reverse primer, polymerase chain reaction, called forward primer, pcr, probe, dna, fluorescence, quencher, rna, enough distance between quencher, primary strand
Abstract
This protocol describes how to in silico-design i) primers ii) probes and iii) gblocks.

i) Primers are complementary sequences to a target region and they define the starting points of the polymerase in a polymerase chain reaction (PCR). The so-called forward primer binds on the primary strand and defines the beginning of the target region, while the so-called reverse primer binds on the secondary strand and defines the end of the target region.
ii) Probes are primer-similar sequences marked with a fluorophore at the 5’ end and a quencher at the 3’ end. The quencher inhibits the emission of any fluorescence until the polymerase cleaves the probe and therefore creates enough distance between quencher and fluorophore leading to a fluorescent signal.
iii) gBlocks are double stranded DNA fragments. They can be used as a positive control within PCR experiments, matching the sequence of the primers and probes exactly. Alternatively, extracts of RNA or DNA can be ordered as positive controls.
Guidelines
There are several design guidelines that should be followed in-silico, to ensure a higher success rate of your assay. Collect all the data in an excel sheet (template given under Supplements). It is recommended to use the "IDT OligoAnalyzer" tool for steps B.2-B.8 and Microsynth as the producing company, since their prices are low and their delivery time short (1-3 days for primers, 3-10 days for probes).
Materials
  • Computer with internet access
  • IDT account
  • JaView (to see Clustal Omega results)
Safety warnings
It can be difficult to fulfill all the mentioned guidelines here, sometimes certain aspects have to be accepted and tested in the lab. Try to fulfill these guidelines: melting temperature, hairpins, homodimers, heterodimers, fluorophores, quenchers.
Define a target
Be sure that your target (specific region on the genome) is chosen sufficiently to answer your specific research question. Depending on the assay, it can be important to focus on conserved regions over many different strains or even species (for example 16S rRNA), or it can be essential to focus on specific regions or mutations in which you can distinguish one or more target strains or variants from others.
Find a suitable DNA or RNA target for your PCR assay. This can be done for example using:
  • Already published targets using research papers or other published sources.
  • Genome databanks (for example NCBI) to research genomes and suitable genes.
Look up the nucleotide sequence of your target. Often, there might be several sequences with minor differences online. It can be helpful to compare all the available sequences using, for example, “Clustal omega” (available via EMBL-EBI: Clustal Omega < Job Dispatcher < EMBL-EBI) and find conserved and variable regions:
  • Download the nucleotide (coding) sequences from your organism via NCBI (fasta format). To limit the number of files, filter thresholds can be set based on your research design.
  • Upload the sequences into Clustal Omega. Depending on the number of sequences, Clustal Omega can take several hours – after you submit, you can close the window and you will receive a notification by e-mail once the task is complete.
  • Open the results in JalView, set color to percentage identity to compare all sequences regarding conserved and variable regions. Nucleotide sequences lacking certain sections of the alignment will be shown as dashed lines. If a whole genome sequence is not available, there will be regions with multiple dashed lines.
Design primers and probes
The following points can be considered and helpful for the correct design of the primer and probes.
Position:
- Primers Primers should be designed to be on conserved regions, to avoid non-binding due to mutations.
- Probe has to be in between the forward and reverse primers, preferably close to one or the other of the primers. If you want to specifically detect mutations (for example SNPs), place the probe such that the the mutation is located in the middle of the probe.
Length:
- Optimal length for primers is typically between 18-30 basepairs (bp).
- Optimal length for probes is typically around 20 bp. If the probe is longer than 30 bp, the probe should also have an additional quencher in the middle of the sequence. By using locked nucleic acids (LNAs, see B.11.a) a probe can be as short as 10 bp.
G/C content:
- The amount of cytosine (C) and guanine (G) should be between 30-80 %.
- Select the target-strand that gives you more C’s in the probe.
Sequence:
- Primers should have no more than two G/C’s in the last 5 bp at the 3’ end.
- Probe should have no G at the 5’ end.
Melting temperature:
- Primers should have a melting temperature between 58-60°C.
- Probes should have a melting temperature approximately 10° higher than the primers, for example between 68-70°C.

  • Certain quenchers may increase the melting temperature, and this should be checked. For example, MGB quenchers (Microsynth, Switzerland) may increase temperatures by up to 15°C.
  • Estimated melting temperatures for primers and probes can vary based on the software and the associated equation used to calculate primer and probe melting temperatures. We suggest using the same software with the same settings when comparing oligos (this ensures that the oligos match relative to each other).
  • To link melting temperature to annealing temperature, we recommend analyzing an oligo set (primers and probe) that you already use in the lab with the same software and settings. This ensures that you have an indication of which annealing temperature is to be used in the PCR cycle. It is often hard to deduce it directly from the melting temperature, since its values vary a lot depending on software and settings. The optimal annealing and extension temperatures should be verified in the lab.
Hairpins:
At the end of the sequence, the ΔGmin is -2 kcal/mole, in the middle of the sequence the maximum recommended ΔGmin is -3 kcal/mole.
For example, a ΔGmin of -5 kcal/mole you should try to avoid by adjusting the oligo sequence.
Homodimers:
At the end of the sequence, the ΔGmin is -5 kcal/mole, in the middle of the sequence the ΔGmin is -6 kcal/mole.
For example, if your primer sequence has homodimer ΔGmin of -10 kcal/mole, we recommend adjusting the oligo sequence.
Heterodimers:
At the end of the sequence, the ΔGmin is -5 kcal/mole, in the middle of the sequence the ΔGmin is -6 kcal/mole.
For example, if your primers have a heterodimer ΔGmin of -10 kcal/mole, we recommend adjusting the oligo sequence.
Fluorophores:
  • Check the detection instrument you want to use and its detection channels: make sure your fluorophores fall within the range of excitation and emission of the detection instrument. Be aware to check all potential instruments, since their detection channels might vary (for example if you want to run your assay on qPCR and dPCR).
  • Normally, the detection instrument manufacturer gives you recommendations for fluorophores in each detection channel (an example is given under Supplements).
  • Check, which producing company (for example Microsynth, IDT or Sigma-Aldrich) can deliver the fluorophore you require. Be aware that depending on the manufacturer, emission and excitation indications for each fluorophore can vary.
Quenchers:
  • Make sure the quencher is in the according quenching range of the emission range for the chosen fluorophore.
  • Check which producing company (for example Microsynth, IDT, Sigma-Aldrich) can deliver the quencher you require and fluorophore pair you require (for example, only some manufacturers may offer the BHQ3 quencher). Be aware that depending on the manufacturer, quenching range can change.
  • Certain quenchers will only work with specific fluorophores, even though other fluorophores might also have their emission range in the quenchers range.
-> For example, MGBQ500 can only be used with FAM.
-> For example, MGBQ530 can only be used with FAM/JOE/Yakima Yellow/HEX
  • Certain quenchers influence the melting temperature, for example MGBQ500 and MGBQ530 may increase the melting temperature by 15-20°C. If your design relies on that temperature increase, it will be hard to change fluorophores in the future (for instance if you require the probe for a multiplex assay with a different fluorophore), since that quencher can only be used with certain fluorophores.
Make sure your oligos are specific by comparing them against other known genomes. We recommend using, for example, the online and publicly available “NCBI Blast” tool. Screen through first column (species) and 7th column (Percentage Identity) to identify matches and the associated alignment.
Make sure your oligos are specific regarding your strain by aligning them against the genome of the strain using the “NCBI align” tool. If more than 1/3 of the oligo-length can bind, indicate it via range of bp on subject and identities. For example, if your forward primer is 25 bp long, write down any other binding locations where 9 or more bp could bind: (for example, 16149-16140 (10/10)).
If required, you can run the PCR in-silico using “CLC workbench” or “Benchling” and screen for potential problems.
Some additional design options:
  • Locked-Nucleic-Acids” (LNA’s) lead to a higher melting temperature, each LNA increases the melting temperature by 2-4°C. They result in a stronger binding, possibly leading to a better detection of SNP mutations. LNA’s should not be used near the 3’ end and G/C content should be between 30-60%. Keep LNA’s at a minimum (maximum 8 LNA’s in 18 bp), no more than 4 LNA’s in a row and no more than 3 G’s in a row.
  • Degenerated basepairs: if you know about a mutation occurring in some strains, you might be able to use degenerated basepairs. For example if at location Y there could be an A or a G base, the producing company will then deliver oligos in both variations within the same tube, leading to amplification of both targets. We note that manufacturers offering degenerate basepairs may not guarantee equimolar ratios sequences in the produced oligos.
  • If you find a suitable primer or probe sequence in a publication, but you need to change one of their oligos or add a new oligo, the IDT “PrimerQuest” tool can be helpful.
  • If you find a suitable target in a publication and want to order the published oligos, be aware that ordering oligos from a different company than the company used for the original publication might lead to differences in the primer or probe melting temperature.
It can be difficult to fulfill all the mentioned guidelines here. Expert judgement can be used to relax some guidelines, acknowledging the need to optimize laboratory testing. We recommend prioritizing the following guidelines: melting temperature, hairpins, homodimers, heterodimers, fluorophores, quenchers.
Design Synthetic DNA positive controls
There are several design guidelines that should be followed in-silico, to ensure a higher success rate of your assay.
The synthetic DNA positive control, such as the IDT gBlock, sequence should include the target region (both primers and the probe sequences) and additionally around 100 bp at the beginning and the end of the sequence (for example, targeting a longer part of the genome for the 100 bp beginning/end).
Synthetic DNA can be ordered for each gene individually or several targets can be combined into one sequence (for example if a multiplex PCR is planned). Each target sequence should be spaced by using some nucleotides in between:
  • If a single synthetic DNA sequence is used, multiplex digital PCR may result in droplets with multiple fluorescence for all targets.
  • To avoid this, synthetic DNA can be cleaved using, for example, Restriction enzymes (e.g., SwaI by New England Biolabs). For this, the restriction sequence ATTTAAT is put in between the target genes. Make sure that this sequence does not otherwise appear in the synthetic DNA sequence. The restriction enzyme targets this sequence, and cannot cut anywhere else on your sequence.
  • If no restriction enzyme sequence is used, you can instead choose 5-10 random nucleotides.
Check that all primers and probes cannot bind anywhere else on the synthetic DNA, such as by using the NCBI align tool or similar. To document non-specific binding, you can take record any potential binding sites.
When uploading a potential synthetic DNA sequence, such as a gBlock, the manufacturer may allow you to check if it is suitable for production. If there are any errors, adjust the sequence to align with manufacturer's recommendations and requirements.
Inputs for multiplexing strategies
Be aware of different assay strategies when trying to use several detection channels:
  • Non-competing: Detect one target in one detection channel using a single probe with a specific fluorophore for each target individually. (1 channel for 1 target)
  • Competing: Detect multiple similar but not identical sequences that differ by one or more mutations in multiple detection channels by designing primers or probes specific to the variants. To do this, design multiple probes with distinct fluorophores in which their sequence differs at the mutation. For example, one probe may be designed to target the wildtype, while the other probe is designed to bind to the variant by targeting the mutation. This way, the two probes will be competing for the same location on the same amplicon, so the same forward and reverse amplicon can be used. (e.g., multiple channels for multiple variants of a single target in which only one probe can bind)
  • Drop-off non-competing: Detect one target in two detection channels. You will design two probes with distinct fluorophores and sequences: both are located between the primers, one probe contains the region with a mutation and the other binds to an alternative conserved region. This way, the two probes will both be able to bind in two different locations at the same time, but one probe (mutation-containing) can only bind on specific targets. (e.g., multiple channels for variants of a single target in which both probes can bind)
Check the compatibility of all oligos:
  • Heterodimers
  • Other binding sites on synthetic DNA
Check the compatibility of all fluorophores:
  • Compare the spectrum of fluorophores one. Choose fluorophores recommended for the specific instrument and compatible with the associated mastermix. Ideally, choose fluorophores that do not have overlapping excitation and emission curves, since this might lead to bleed-over in other detection channels.
If you want to use more fluorophores than detection channels available, there are several potential solutions to this:
  • Bleed-over: Order probes with fluorophores, that specifically bleed over in 2 already used channels. Their signal will be distinguishable from the others due to the bleed-over and therefore shifted location on a 2D plot. (1.5 targets per channel)
  • Concentration: Order different probes with the same fluorophores. When adding them into the mastermix, regulate the concentration (for example add only half the concentration of one probe). If the assay is set-up well and no rain is interfering, the signals can be distinguished. (1-4 targets per channel)
  • Mixed fluorophores: Order a probe in two fluorophores that have already been used. When adding it into the mastermix, regulate its concentration. Since this probe is reduced in concentration and available in two fluorophores, its signal is distinguishable. (1.5 targets per channel)
  • Qualitative: If you are interested in screening samples for the presence or absence of certain genetic elements, you can order each probe with the same fluorophore. For example if you are measuring total mutations of a certain gene versus wildtype amounts, you can have several mutation-specific probes all with the same fluorophore.
Compare PCR cycling conditions; can all oligos be run at the same conditions or can you modify the oligos accordingly:
  • If times vary, you can typically use the longest time.
  • If enzyme activation or denaturation temperatures vary, attempt to choose a temperature that will work for your specific mastermix. The temperature choice is typically enzyme-dependent and a minor modification in temperature may have minimal influence on the assay. It is important to verify that the updated temperatures work with your reagents.
  • If annealing or annealing/extension temperature varies, check if you can adjust the sequence of the oligonucleotides to bring all annealing temperatures in a close range of within approximately 2°C to enable multiplexing. Annealing temperatures influence specificity and efficacy of PCR reactions. Using non-optimal annealing temperatures can impact assay performance.
Check your mastermix and enzyme reagents: depending on the PCR instrument, you may be required to use manufacturer-specified products. Depending on the product, the time or temperature for the activation/denaturation/extension steps may be specified by the manufacturer, and may be distinct from previously published assay information.
Helpful tools
Sequence comparison tools, such as EMBL-EBI Clustal Omega: Compare sequences to find conserved and variable regions.
Oligonucleotide analyzer tools, such as IDT OligoAnalyzer: Check oligos for their length, G/C content, melting temperature, hairpins, homo and hetero dimers. Be aware that changing the Mg2+ concentration has a significant influence on the melting temperature – therefore always use the same settings to be able to compare oligos. For example, the following settings could be used: qPCR, DNA, 0.4 µM Primer/ 0.2 µM Probe, 50 mM Na, 3 mM Mg, 0.8 mM dNTPs.
Primer design tools, such as IDT PrimerQuest: Set the boundary conditions and the algorithm finds suitable oligos. Be aware that changing the parameters (for example Mg2+) influences the search – therefore always use the same settings to be able to compare oligos. For example, the following settings could be used: qPCR, DNA, 0.4 µM Primer/ 0.2 µM Probe, 50 mM Na, 3 mM Mg, 0.8 mM dNTPs.
Specificity testing tools, such as NCBI Blastn: Blast your oligo sequence against all genomes in the databank to see if the oligo is specific.
Sequence alignment tools, such as NCBI Align: Blast your oligo sequence against the genome of your species of interest or the sequence of the gBlock to see if the oligo can bind somewhere else. Use the “Alignments” window for better overview of results.
Bioinformatics software tools, such as CLC workbench or Benchling: Run the PCR reaction in-silico to see efficiencies.
Supplements
ABC
Assay nameName of the assay, normally target gene S gene Δ69-70
Target length (bp)Number of bases between forward and reverse primers108
Personal numberPersonal oligo number (all tubes might be labelled with it, reference to personal primer-list)15
Oligo nameName of the oligo (either from paper or self-given)Yale_69-70_Cy5_P
DNA/RNA sequence (5’-3’)Sequence of bases within oligoTTCCATGCTATACATGTCTCTGGGA
ModificationsFluorophore, quencher, LNA’s,…Cy5/BHQ2
Length (bp)Number of bases per oligo25
G/C content (%)Amount of guanine and cytosine within oligo44
Melting temperature (°C)Calculated via software with specific settings65
SourceReference to paper or self-designed"Multiplexed RT-qPCR to screen for SARS-COV-2 B.1.1.7, B.1.351, and P.1 variants concern V.2" by Vogels, Fauver and Grubaugh 2021
AdjustmentsIf oligo used from paper, indicate if you changed anything (modification, sequence,…) -
Hairpin (kcal/mole)Indicate any ΔGmin above the threshold, mark values red if significantly above threshold (-5 kcal/mole).-5, -3, -2.01 (red number invented for example purpose)
Selfdimer (kcal/mole)Indicate any ΔGmin above the threshold, mark values red if significantly above threshold (-10 kcal/mole).-10, -8.07, -5.38, -5.02 (red number invented for example purpose)
Heterodimer intra (kcal/mole) Any heterodimers within the oligos per assay according to their “personal number”. Indicate any ΔGmin above the threshold, mark values red if significantly above threshold (-10 kcal/mole). 2: -5.02, 9: -6.5, -5.02
Heterodimer inter (kcal/mole)Any heterodimers within the oligos per multiplex assay according to their “personal number”. Indicate any ΔGmin above the threshold, mark values red if significantly above threshold (-10 kcal/mole).4: -5.02, 8: -5.02, 10: -8.45, -8.3, -6.6, -6.5, 40: -5.02
Specific all genomesUse NCBI Blastn to see if oligo can bind on any other genome. Indicate species and “Percentage identity”E. coli MG1655 (31%) (invented for example purpose)
Specific used genomeUse NCBI Align to see if oligo can bind on any other location on the genome. If more than 1/3 of the oligo-length can bind, indicate it via range of bp on genome and identities.16149-16140 (10/10), 18288-18289 (9/9)
Specific gBlockUse NCBI Align to see if oligo can bind on any other location on the gBlock. Indicate it via range of bp on gBlock and identities.132-138 (4/7) (invented for example purpose)
Overview assay design attributes (A=assay design, B=explanation, C=example)