Nov 15, 2020
Designing gRNA using CRISPRdirect
This protocol is a draft, published without a DOI.
- Gatesgibson 1
- 1Auburn University
Protocol Citation: Gatesgibson 2020. Designing gRNA using CRISPRdirect. protocols.io https://protocols.io/view/designing-grna-using-crisprdirect-bpnnmmde
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 12, 2020
Last Modified: November 15, 2020
Protocol Integer ID: 44462
Keywords: CRISPR, gRNA, CRISPRdirect, Benchling, grna for crispr, target gene for these grna, designing grna, target gene, crispr, using crisprdirect, model mouse organism mus musculus, crisprdirect this protocol, grna, igf1 gene, gene, crisprdirect, cas9 application, gn,
Disclaimer
This protocol is intended for the Schwartz lab
Abstract
This protocol is designed to help guide the user through the use of CRISPRdirect to design gRNA for CRISPR/Cas9 applications in the model mouse organism Mus musculus. The target gene for these gRNA is the IGF1 gene, more specifically the C-domain located within Exon 3.
The planned edits to be made requiring the gRNA to be designed, are at positions 83-84 respectively within the C-domain. These edits are SS -> GN.
Image Attribution
Author
Software used
In this protocol, the software used to generate both inputs and outputs are CRISPRdirect and Benchling
Software
CRISPRdirect
NAME
Naito Y, Hino K, Bono H, Ui-Tei K.
DEVELOPER
SOURCE LINK
Using Benchling, the user can easily access the genetic information needed to begin designing gRNA using the selected gRNA software.
In this example, the gene in question is the IGF1 gene in the model organism Mus musculus.. More specifically, the C-domain within Exon 3.
CRISPRdirect Input
In the above image, there exists:
- Help page (top right)
- Input boxes (accession numbers or raw sequences)
- sequence file upload
- PAM entry
- Host organism selection
If any of the above is not familiar or creates confusion, the "help" button provides a detailed description on how to use this software, including a tutorial video.
The gRNA design process should begin by inputting your selected (to be edited) sequence through one of the three entry methods. (In this example, the raw FASTA format was used)
FASTA format:
This should be preceeded by the following heading in the insert box
">[insert desired output name]"
entering down to the next line, the user will paste the DNA sequence. This is where knowledge about the aforementioned gene sequence in question is recommended before use of the gRNA design software. For this example, Benchling was used to identify the target area and the sequence pasted in the entry box was derived from there.
In this example, the following should look like
>Mus musculus IGF1 C-domain
GGCTATGGCTCCAGCATTCGGAGGGCACCTCAGACA
Next, it is imperative to select the proper PAM sequence for gRNA design (An arbitrary sequence using IUB codes (N, R, Y, ...) can be specified.)
In this example, CRISPRdirect will be using the default PAM - NGG
Lastly for the input section, the host organism should be selected from the dropdown menu. In this experiment, the host organism is Mouse (Mus musculus) genome, GRCm39/mm39 (Jun, 2020)
Hit the design button
CRISPRdirect Output
In the above image, there exists:
- A recap of the selected input
- position in the selected sequence
- target sequence for gRNA design
- GC%
- Tm
- Restriction sites if applicable
- Number of sites
- graphical view
- Data export
comparable to the input page, there exists a "?" button next to the "results" header that will explain the output in a detailed manner. Another tool for information is the "?" button next to the "number of sites" header that explains the relative importance of the numbers given in that sections.
In this example, CRISPRdirect generated 3 results for the search inquiry.
Based on the position of the edit you'd like to make, the results given may be more or less useful to your experimental protocol. In this example, the first two results show PAM sites on the left-most ends of the + strand. This placement may be too far downstream from the planned edit and therefore the third option was picked as it places the complex
Lastly, next to the target sequence is a [gRNA] button that loads the guide-RNA for the selected location. In this example, the third gRNA was chosen at is is closest to the selected site for editing. Likewise, this choice has the added bonus of a restriction enzyme site which may be used for future efficacy studies.