Dec 24, 2024
Design strategy for DiCre-mediated inducible gene knockout in the malaria parasite
- 1School of Infection and Immunity, University of Glasgow
Protocol Citation: Anagha Rajesh Salvi, Abhinay Ramaprasad 2024. Design strategy for DiCre-mediated inducible gene knockout in the malaria parasite . protocols.io https://dx.doi.org/10.17504/protocols.io.eq2ly68begx9/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 22, 2024
Last Modified: December 24, 2024
Protocol Integer ID: 116795
Keywords: malaria, DiCre, Plasmodium falciparum, Plasmodium
Funders Acknowledgements:
MRC Career Development Award
Grant ID: MR/Z504762/1
Abstract
This protocol describes a detailed strategy for inducibly knocking out a target gene in Plasmodium species using the Dimerisable Cre (DiCre) recombinase system, with a primary focus on Plasmodium falciparum1,2. The approach involves flanking a target genomic region with loxP sites (“flox”), priming it for precise DiCre-mediated excision when induced with the drug rapamycin (RAP). We describe a widely used method (in studies like 3,4 for example) for deleting specific functional domains of a gene by incorporating loxP sites within synthetic introns (loxPint)5, combined with simultaneous C-terminal tagging with an epitope tag. This protocol is meant for students and researchers new to designing DiCre strategies, providing step-by-step guidance on selecting the target region for floxing, designing guide RNAs, and creating a repair template for Cas9-enhanced homology-directed repair to introduce loxP sites at the desired locus.
Guidelines
1) This protocol is meant as guidance to get started with designing a DiCre strategy. As with such strategies, there is definitely not "one way" to do it and a lot of variations can exist suited to different needs.
2) If the target gene has introns, exclude any introns within the target region when recodonising. If suitable, replace an existing intron with the loxPint.
3) Sequences of 2 commonly used loxPints, loxP and 3HA tags attached.
Preparing an annotated sequence file for the gene of interest
Preparing an annotated sequence file for the gene of interest
Download the sequence in FASTA format. Select “Download Gene” at the top of the gene page and choose following options
This will generate a FASTA file containing the gene sequence flanked by 1000 nucleotides on either side, for designing homology arms or primers for diagnostic PCR.
Open the FASTA file in your favourite sequence editor or molecular biology tool (we use SnapGene). Annotate the sequence with gene, intron, exon and the gene’s critical functional or catalytic domain as features. Coordinates of functional domains can be obtained from PlasmoDB (Protein features and properties > InterPro Domains).
Note: You can skip these steps if you already have access to a fully annotated genome locally.Using a
genome visualisation tool like IGV, you can navigate to the gene locus and export the sequence and annotation as a GenBank file.
wildtype_locus.dna
Selecting the target region to be floxed
Selecting the target region to be floxed
Predict gRNAs for the entire gene using Eukaryotic Pathogen CRISPR guide RNA/DNA Design Tool (EuPaGT)7.
Choose 2 or 3 gRNA target sites with good scores (efficiency scores > 0.5, aiming for the highest) close to either the functional domain or near the C terminal end of the gene. Make sure that the sequences are unique and not present in any other region of gene. Add them as features in wildtype_locus.dna.
guide target sites in orange.
Choose a target region that-
i) begins upstream of the gene’s critical functional or catalytic domain and extends to the end of the gene,
ii) starts immediately after an AG in an AG-AT/AA/GA/GT sequence to mimic the exon-intron boundary in Plasmodium8(this will be where loxPint would be inserted later). If such a junction is not available within a reasonable distance upstream of the functional domain, an AA-AT/AA/GA/GT sequence could serve as an alternative.
iii) includes at least two of the selected gRNAs within 100 bp of its boundaries. While this proximity is ideal for efficient Cas9-mediated HDR, distances up to 500 bp have been successfully used in our experience.
target region in pink.
Exon-intron junction
Designing the repair template
Designing the repair template
Recodonise the selected target region (excluding any introns and the stop codon) using the JAVA Codon Adaptation Tool9.
Note: This tool is preferred as it achieves higher base substitution rates compared to codon optimisation tools typically provided by gene synthesis companies. Another good alternative is VectorBuilder.
Create a new DNA sequence file with the following sequences arranged in this order-
i) a loxPint sequence,
ii) the recodonised sequence from Step 7.
ii) a triple HA tag sequence (or any peptide tag of your choice).
iv) a stop codon (TAA), and finally
v) a loxP sequence
syn_gene.dna
Take care to add the stop codon after the tag.
If not already achieved during recodonization, further modify the gRNA target sites by introducing silent base substitutions to disrupt the PAM site (NGG). If disrupting the PAM site is not feasible, introduce as many mismatches as possible within the target sequence to minimize off-target effects.
By Mouagip - Codons aminoacids table.png, Public Domain, https://commons.wikimedia.org/w/index.php?curid=5986132
PAM site AGG changed to ACG (highlighted)
or silent mismatches (top) introduced in gRNA sequence (bottom)
Verify the accuracy of the strategy by replacing the target region in the gene with this designed repair sequence and ensure that the translated protein sequence (across the inserted loxPint) remains unchanged.
integrated_locus.dna
verify amino acid sequence is unchanged after inserting loxPint
Designing the repair construct for assembly using Gibson/In-Fusion cloning
Designing the repair construct for assembly using Gibson/In-Fusion cloning
Select 400–500 bp regions flanking either end of the target region as homology arms, ensuring that amplification primers 20-25 bps long with a melting temperature (Tm) of 55–60 °C can be designed ( P. falciparum has a highly AT-rich genome).
Design primers to amplify homology arms from genomic DNA with 20 bp overhang sequences homologous to the ends of the synthesised construct and the vehicle plasmid backbone.
Common primers to amplify backbone-
1) m13f_rev : ACTGGCCGTCGTTTTAC
2) m13r_rev : GTCATAGCTGTTTCCTG
Common primers to amplify synthesized construct-
3) loxPint_f : GTAATACAGAATATGTATAAAATATATGCAAG (for SUB2:loxPint)
4) loxP_r : ATAACTTCGTATAATGTATGCTATACGAAGTTATTTAAGCG
Primers to amplify LHA and RHA (20 bp overhangs in bold)-
5) LHA_F : GTTGTAAAACGACGGCCAGT-specific sequence
6) LHA_R : TTATACATATTCTGTATTAC-specific sequence
7) RHA_F : CATACATTATACGAAGTTAT-specific sequence
8) RHA_R : ACACAGGAAACAGCTATGAC-specific sequence
Designing diagnostic PCRs
Designing diagnostic PCRs
Design two primers on outside RHA and LHA regions (dia_1 and dia_2) to check for integration and excision. You can additionally create an excised locus file (by deleting region between two loxP sites and retaining one loxP site) to easily check for expected amplicon size or map sequenced amplicons.
gene_dia_1 - loxP_R for 5' integration and loxPint_F - gene_dia_4 for 3' integration
excised_locus.dna
gene_dia_1 - gene_dia_2 to check for excised locus upon RAP treatment.
Protocol references
1. Collins, C.R., Das, S., Wong, E.H., Andenmatten, N., Stallmach, R., Hackett, F., Herman, J.P., Müller, S., Meissner, M. and Blackman, M.J., 2013. Robust inducible cre recombinase activity in the human malaria parasite p lasmodium falciparum enables efficient gene deletion within a single asexual erythrocytic growth cycle. Molecular microbiology, 88(4), pp.687-701. https://doi.org/10.1111/mmi.12206
2. Knuepfer, E., Napiorkowska, M., Van Ooij, C. and Holder, A.A., 2017. Generating conditional gene knockouts in Plasmodium–a toolkit to produce stable DiCre recombinase-expressing parasite lines using CRISPR/Cas9. Scientific reports, 7(1), p.3881. https://doi.org/10.1038/s41598-017-03984-3
3. Thomas, J.A., Tan, M.S., Bisson, C., Borg, A., Umrekar, T.R., Hackett, F., Hale, V.L., Vizcay-Barrena, G., Fleck, R.A., Snijders, A.P. and Saibil, H.R., 2018. A protease cascade regulates release of the human malaria parasite Plasmodium falciparum from host red blood cells. Nature microbiology, 3(4), pp.447-455. https://doi.org/10.1038/s41564-018-0111-0
4. Ramaprasad, A., Burda, P.C., Calvani, E., Sait, A.J., Palma-Duran, S.A., Withers-Martinez, C., Hackett, F., Macrae, J., Collinson, L., Gilberger, T.W. and Blackman, M.J., 2022. A choline-releasing glycerophosphodiesterase essential for phosphatidylcholine biosynthesis and blood stage development in the malaria parasite. Elife, 11, p.e82207. https://doi.org/10.7554/eLife.82207
5. Jones, M.L., Das, S., Belda, H., Collins, C.R., Blackman, M.J. and Treeck, M., 2016. A versatile strategy for rapid conditional genome engineering using loxP sites in a small synthetic intron in Plasmodium falciparum. Scientific Reports, 6(1), p.21800. https://doi.org/10.1038/srep21800
6. Alvarez-Jarreta et al., VEuPathDB: the eukaryotic pathogen, vector and host bioinformatics resource center in 2023, Nucleic Acids Research, Nucleic Acids Research, Volume 52, Issue D1, 5 January 2024, Pages D808–D816 https://doi.org/10.1093/nar/gkad1003
7. Peng, D. and Tarleton, R. 2015. EuPaGDT: a web tool tailored to design CRISPR guide RNAs for eukaryotic pathogens. Microbial Genomics. https://doi.org/10.1099/mgen.0.000033
8. Zhang, X., Tolzmann, C.A., Melcher, M., Haas, B.J., Gardner, M.J., Smith, J.D. and Feagin, J.E., 2011. Branch point identification and sequence requirements for intron splicing in Plasmodium falciparum. Eukaryotic cell, 10(11), pp.1422-1428. https://doi.org/10.1128/ec.05193-11
9. Grote, A., Hiller, K., Scheer, M., Münch, R., Nörtemann, B., Hempel, D.C., Jahn, D., 2005. JCat: a novel tool to adapt codon usage of a target gene to its potential expression host, Nucleic Acids Research, Volume 33, Issue suppl_2, Pages W526–W531, https://doi.org/10.1093/nar/gki376
Acknowledgements
Based on and improved upon workflows employed at the Malaria Biochemistry Laboratory, Francis Crick Institute.