Jul 02, 2020
ddPCR Titration of Lentivirus Vectors
- 1Addgene
Protocol Citation: Addgene The Nonprofit Plasmid Repository 2020. ddPCR Titration of Lentivirus Vectors. protocols.io https://dx.doi.org/10.17504/protocols.io.be7ijhke
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 16, 2020
Last Modified: July 02, 2020
Protocol Integer ID: 35786
Keywords: ddPCR, titer, Lentivirus, RRE,
Abstract
This protocol describes ddPCR titration of Lentivirus vectors. To see the full abstract and additional resources, visit https://www.addgene.org/protocols/lentivirus-ddpcr-titration/.
Sample Data:
- When analyzing data there should be a clear distinction between negative droplets (black) and positive droplets (blue/green).
- The concentration of RRE positive droplets in the untransduced control should be close to zero (A01).
- In this protocol, the lentiviral particles are serially diluted and used to transduce HEK293T cells. Genomic DNA is extracted from the target cells and assayed for integrated copies of RRE. Since the samples that are assayed are diluted 2-fold serially, the concentration of RRE positive droplets should decrease by a factor of 2 across the dilutions. RPP30 copies should be relatively constant across samples.
- In the RRE example below, 2-fold serial dilutions of a sample were loaded in wells B01-H01.
- As shown in the image and table below, the concentration of RRE positive droplets increases by a factor of ~2 as you progress from the higher dilutions to the lower dilutions (blue).
- The concentration of RPP30 positive droplets stays relatively even across samples (green).
- To increase the accuracy of the titer, calculate and average of several dilutions.
Figure 1: ddPCR Lentivirus sample data, RRE positive (blue) and negative (black) droplets
FIgure 2: ddPCR Lentivirus sample data, RPP30 positive (green) and negative (black) droplets
Table: Example dilutions and titrations
Guidelines
Workflow Timeline
- Day 1: Seed and transduce cells
- Day 4: Treat cells with benzonase and harvest cells
- Day 4+: ddPCR and analysis
Materials
Equipment:
- class II, Type A2 Biological Safety Cabinet, Labconco 302411100
- aspirating Unit
- microcentrifuge, Eppendorf, 5425R
- droplet digital PCR System, Bio-Rad, DX200
- thermal Cycler, Bio-Rad, T100
- PCR Plate Sealer, Bio-Rad, PX1
- 1-10µL single channel pipette
- 20-200µL single channel pipette
- 200-1000µL single channel pipette
- 2-50µL multichannel pipette
- 20-200µL multichannel pipette
- ice bucket
- 96-well freezer blocks
- vortex, VWR, 10153-688
- mini Centrifuge, Thermo Scientific, 10199-452
Reagents and Consumables:
- GeneJet Genomic DNA Purification Kit, Thermo Fisher, K0721
- 6-well tissue culture treated dish, VWR, 29442-042
- DMEM, high glucose, pyruvate, Corning, 10-013-CV
- heat inactivated premium grade, fetal bovine serum, Seradigm, 1500-050H
- Glutagro, 200 mM, Corning, 25-015-CI
- 1X Phosphate Buffered Saline, Corning, 21-040-CV
- TrypLE, Thermo Fisher, 12605010
- ethanol, VWR, EX0276-1
- benzonase 250U/µl, Millipore #71205-3
- polybrene 10mg/ml, Millipore, TR-1003-G
- molecular Biology Grade Water, Hyclone, SH30538.02
- ddPCR Supermix for Probes no dUTP, Bio-Rad,1863023
- droplet generation oil, Bio-Rad, 1863005
- DG8 cartridge, Bio-Rad, 1864008
- DG8 gasket, Bio-Rad, 1863009
- DG8 cartridge holder, Bio-Rad, 1863051
- 8-strip PCR tubes, Axygen, PCR-02-FCP-C
- ddPCR 96-well PCR plates, Bio-Rad, 12001925
- pierceable Foil Heat Seal, Bio-Rad, 1814040
- polystyrene Reservoirs, VWR, 89094-662
- microcentrifuge tubes, VWR, 87003-294
- primers/probe targeting RRE:
- forward primer: tgtgccttggaatgctagt
- probe (FAM): tttggaatcacacgacct
- reverse primer: aatttctctgtcccactccatc
- PrimePCR ddPCR Copy Number Assay: RPP30, Human, Bio-Rad, 10031244
Reagent Preparation:
- DMEM Complete
- 500 mL DMEM, high glucose, pyruvate
- 55 mL Heat inactivated premium grade, fetal bovine serum
- 5 mL Glutagro
- 50U/mL benzonase
- 15 mL DMEM Complete
- 3 µL of 250U/µL Benzonase
Safety warnings
Lentivirus is generally considered biosafety level 2+. Please ensure that you are in compliance with your institution’s biosafety regulations.
Before start
- Thaw the master mix, primers/probe mixes and samples on ice before use.
- Wipe down all pipettes and surfaces with 10% bleach.
Transducing Cells
Transducing Cells
Thaw the virusOn ice .
Prepare the following dilution series of virus in DMEM complete:
Note
- When adding the virus to the diluent, pipette 5 times, to remove virus from pipette tip.
- To mix each dilution, set the P200 pipette to 200 µL and pipette 10-20 times.
- Use a new pipette tip to transfer the virus to the next dilution.
- Repeat for all dilutions.
| Dilution Factor | Virus | Media | Total Volume | |
| 2.5 | 160µL viral stock | 240µL | 400µL | |
| 5 | 200µL of 2.5-fold dilution | 200µL | 400µL | |
| 10 | 200µL of 5-fold dilution | 200µL | 400µL | |
| 20 | 200µL of 10-fold dilution | 200µL | 400µL | |
| 40 | 200µL of 40-fold dilution | 200µL | 400µL | |
| 80 | 200µL of 80-fold dilution | 200µL | 400µL | |
| 160 | 200µL of 160-fold dilution | 200µL | 400µL |
Table: Dilution series of virus in DMEM complete
Add 150 µL of each viral dilution to a well of a 6-well plate (1 dilution per well). Leave one well untransduced.
Seed 300,000 cells/well in 1350 µL media and 11.1µg/mL Polybrene into the wells containing the virus and the untransduced control.
Note
*Pro-Tip*
For even seeding, prepare a batch for 10 wells with 3,000,000 cells in 13.5 mL of media and 11.1µg/mL Polybrene. Mix the cell suspension well before seeding.
Note
When seeding, 150 µL of virus is being diluted an additional 10-fold in media therefore the final dilutions range from 25-1600-fold.
Mix each well with a 1mL pipette 5-10 times.
Note
The final volume in the well is 1.5mL and the final Polybrene concentration is 10µg/mL.
Mix well and incubate 72:00:00 .
Benzonase Digestion and Cell Harvest
Benzonase Digestion and Cell Harvest
Gently aspirate media from the 6-well plates.
Add 1.5 mL of 50U/mL Benzonase in DMEM complete to each well.
Incubate at 37 °C for 00:30:00 .
Gently aspirate media from wells.
Wash wells with 1 mL of 1X PBS and aspirate.
Detach cells by incubating with 200 µL TrypLE for 00:01:00 -00:02:00 .
Resuspend cells in 500 µL DMEM complete and transfer to a microcentrifuge tube.
Centrifuge for 00:05:00 at 100 x g .
Gently aspirate supernatant.
Wash cell pellets in 500 µL PBS.
Centrifuge for 00:05:00 at 100 x g .
Gently aspirate supernatant.
Extract genomic DNA according to the GeneJet Genomic DNA Purification Kit instructions.
Determine the concentration of each sample on a spectrophotometer.
Prepare 25ng/µL stocks of each sample. Samples can be used for ddPCR immediately or stored at -20 °C until ready to use.
Preparation for ddPCR
Preparation for ddPCR
Thaw samples, primers/probe mixes, and master mix on ice.
Before handling any viruses get materials ready.
Vortex primers/probe mixes and master mix for 00:00:15 then spin 00:00:10 in a mini centrifuge and place on ice.
Wipe down a DG8 cartridge holder with bleach and place in the Biological Safety Cabinet (BSC).
Make sure that the BSC is supplied with sufficient pipette tips.
Pre-warm the 96-well plate sealer by gently touching the screen.
Preparation of the Master Mix
Preparation of the Master Mix
Place a ddPCR plate onto a chilled 96-well freezer block and set aside in the BSC to cool.
Prepare the RRE/RPP30 master mix in a microcentrifuge tube as shown below. For 8 samples prepare enough master mix for 9 samples.
| Component | Volume | 9X Volume | Final Concentration | |
| 2X ddPCR Supermix for Probes, no dUTP | 10µL | 90µL | 1X | |
| 20X RRE target primers/probe (FAM) | 1µL | 9µL | 900nM/250nM | |
| 20X RPP30 primers/probe (HEX/VIC) | 1µL | 9µL | 900nM/250nM | |
| Nuclease-free water | 4µL | 36µL | ||
| Total Volume | 16µL | 144µL |
Table: RRE/RPP30 Master Mix
Vortex the master mix for 00:00:15 and spin in a mini centrifuge for 00:00:10 before use.
Place an 8-well PCR tube strip into a chilled 96-well freezer block.
Add 16 µL of the master mix to each PCR tube. Be careful to dispense to the bottom of the tube without collecting drops along the side of the tube.
Add 4 µL of the 25ng/µL samples the appropriate PCR tubes. Pipette back and forth 5 times.
Generating the Droplets
Generating the Droplets
Place a DG8 cartridge into the cartridge holder.
Using a 2-50µL multichannel pipet, load 20 µL of the reaction mixtures into the middle wells of the cartridge.
Add 800 µL of droplet generation oil to a polystyrene reagent reservoir.
Using the 20-200µL multichannel pipet, load 70 µL of droplet generation oil into the bottom row of wells.
Cover the cartridge with the DG8 gasket, making sure that it is secure.
Transfer the cartridge holder to the droplet generator. Close the lid and wait for the droplets to be generated.
Once the droplets have been generated, use a 20-200µL multichannel pipette to aspirate 40 µL of droplets.
Note
*Pro-Tip*
To ensure that the droplets are not disrupted insert the pipette tips directly in the center of the well and tilt to a 45-degree angle. Count to 20 while slowly and gently aspirating the droplets.
Transfer the droplets to a prechilled PCR plate.
Note
*Pro-Tip*
To ensure that the droplets are not disrupted insert the pipette tips and gently touch the bottom of the well. Lift the tips ~1mm. Touch the side of the well and tilt the pipette tips at a 45-degree angle. Count to 20 while slowly and gently dispensing the droplets down the side of the tube.
Place a Pierceable Foil Heat Seal on the PCR plate with the red line facing up. If the plate sealer is not at temperature, touch the screen on the plate sealer to allow it to get to temperature. Once the temperature is reached, place the PCR plate with the foil onto the metal support block. Place the block in the plate sealer and press the ‘Seal’ button.
After the plate has been sealed, proceed to thermocycling.
Thermal Cycling
Thermal Cycling
Run the following PCR parameters:
| Cycling Step | Temperature (oC) | Time (min) | Ramp Rate (oC/sec) | # Cycles | |
| Enzyme Activation | 95 | 10 | 2 | 1 | |
| Denaturation | 94 | 0.5 | 2 | 40 | |
| Annealing/Extension | 60 | 1 | 2 | 40 | |
| Enzyme Deactivation | 98 | 10 | 2 | 1 | |
| Hold | 4 | ∞ | 2 | 1 |
Table: PCR parameters
After PCR is complete, transfer the plate to the Droplet Reader.
Open the QuantaSoft software to set up a new plate layout. Designate the sample name, experiment type, supermix type (ddPCR Supermix for Probes), the target names and target types.
When the plate layout is complete , select ‘Run’ to begin the droplet reading.
When the droplet reading is complete, export the data from all wells as a CSV file which will be used to calculate the titer.
Calculations
Calculations
To calculate the titers, first calculate the number of viruses per genome:
Viruses/genome = 2*(Copies/20µL RRE)/(Copies/20µL RPP30)
Use the viruses/genome to calculate the infectious titer:
Infectious titer = (viruses/genome)*(#cells/well)*(dilution factor)/(virus volume)
Take the average infectious titer obtained from the appropriate dilutions to calculate the final infectious titer.