Nov 22, 2023
  • 1University of California, San Diego
Icon indicating open access to content
QR code linking to this content
Protocol CitationChien-Ju Chen, Kian Kalhor, Kun Zhang 2023. DART-FISH Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.e6nvwjxnzlmk/v1
Manuscript citation:
Kalhor, K., Chen, CJ., Lee, H.S. et al. Mapping human tissues with highly multiplexed RNA in situ hybridization. Nat Commun 15, 2511 (2024). https://doi.org/10.1038/s41467-024-46437-y
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 02, 2023
Last Modified: November 22, 2023
Protocol  Integer ID: 82786
Keywords: multiplexed rna in situ hybridization, fish protocol in the manuscript mapping human tissue, multiplexed rna, multiplexed in situ hybridization technique, situ hybridization, manuscript mapping human tissue, situ hybridization technique, applicability to different human tissue type, different human tissue type, steps of dart, situ padlock probe capture, tissue, fish protocol, dart
Abstract
In the manuscript Mapping Human Tissues with Highly Multiplexed RNA in situ Hybridization
(https://doi.org/10.1101/2023.08.16.553610), we describe a highly multiplexed in situ hybridization technique based on in situ padlock probe capture and demonstrate in applicability to different human tissue types. This protocol details the rolony generation and decoding steps of DART-FISH.
Materials
Reagents
MaterialSupplierCatalog Number
UltraPure™ DEPC-treated Water 1LThermoFisher Scientific750023
Pierce™ 16% Formaldehyde (w/v), Methanol-freeThermoFisher Scientific28908
PBS - Phosphate-Buffered Saline (10X) pH 7.4, RNase-freeThermoFisher ScientificAM9624
Ethyl alcohol, PureSigma-AldrichE7023
Triton™ X-100 solutionSigma-Aldrich93443
pepsinSigma-Aldrich10108057001
SuperScript™ IV Reverse TranscriptaseThermoFisher Scientific18090010
SUPERase-In RNase inhibitorThermoFisher ScientificAM2696
Advantage® UltraPure dNTP Combination KitClonTech639132
RNase inhibitorEnzymaticsY9240L
Aminoallyl dUTP, 4 mM in TE buffer *UltraPure Grade*, Anaspec IncAnaspec (VWR)AS-83203
BS(PEG)9ThermoFisher Scientific21582
UltraPure™ DNase/RNase-Free Distilled WaterTheroFischer Scientific10977023
Ribonuclease; RNAse H; Conc. 5,000 U/mL; 5,000 U; incl. 10X bufferFisher Scientific50305945
RNase Cocktail™ Enzyme MixInvitrogenAM2288
Ampligase® Enzyme and BufferVWR76081-598
SSC (20X), RNase-freeThermoFisher ScientificAM9763
Formamide (Deionized)ThermoFisher ScientificAM9342
BSA, Molecular Biology GradeNEBB9000S
Phi29 DNA polymerase (10U/uL)ThermoFisher ScientificEP0094
Acryloyl-X, SE in DMSO ThermoFisher ScientificA20770
Acrylamide/Bis-acrylamide, BioReagent, for molecular biology, 37:1 (ratio)Sigma-AldrichA6050-100ML
Ammonium persulfateSigma-AldrichA3678
TEMEDFisher Scientific17919
gel slick solutionLonza50640
TrueBlack lipofuscin autofluorescence quencherBiotium23007
Silicone Isolators JTR20R-2.5 20mm DIA x 2.4 mm Depth 25 x 25mm OD No PSAGrace Bio-Labs664304
Coverslips, Glass, 18mm dia.Ted Pella260369
Azer Scientific cover glass, No. 1.5, 24 x 60 mmNeta ScientificAzer-1152460

Probes
Oligo nameVendorSequence
Acr_dc10-Cy5_N9IDT/5AmMC12/CCGATAGTCACGATCTGTGGNNNNNNNN*N
Acr_dc7-488_dT20IDT/5Acryd/CATGGATTCGCGGAGGATCATTTTTTTTTTTTTTTTV*N
rca_primerIDTGATATCGGGAAGCTGA*A*G
DARTFISH_anchor_Cy3IDT/5Cy3/CTTCAGCTTCCCGATATCCG
dcProbe7-AF488IDT/5Alex488N/TGATCCTCCGCGAATCCATG
dcProbe10-ATTO647NIDT/5ATTO647NN/CCACAGATCGTGACTATCGG
dcProbe0-AF488IDT/5Alex488N/TGTATCGCGCTCGATTGGCA
dcProbe0-Cy3IDT/5Cy3/CGTATCGGTAGTCGCAACGC
dcProbe0-ATTO647NIDT/5ATTO647NN/ACGCTACGGAGTACGCCACT
dcProbe1-AF488IDT/5Alex488N/TCTTGCGTGCGATACGGAGT
dcProbe1-Cy3IDT/5Cy3/AACGGTATTCGGTCGTCATC
dcProbe1-ATTO647NIDT/5ATTO647NN/CTGGTTCGGGCGTACCTAAC
dcProbe2-AF488IDT/5Alex488N/AGAACTTGCGCGGATACACG
dcProbe2-Cy3IDT/5Cy3/CTACTTCGTCGCGTCAGACC
dcProbe2-ATTO647NIDTGACGAACGGTCGAGATTTAC/3ATTO647NN/
dcProbe3-AF488IDT/5Alex488N/GAATTGTCCGCGCTCTACGA
dcProbe3-Cy3_2IDT/5Cy3/TCGTACTTCGACGGCACTCA
dcProbe3-ATTO647NIDT/5ATTO647NN/AACTGCGACCGTCGGCTTAC
dcProbe4-AF488IDT/5Alex488N/CGGAATACGTCGTTGACTGC
dcProbe4-Cy3IDT/5Cy3/TACCATTCGCGTGCGATTCC
dcProbe4-ATTO647N_2IDT/5ATTO647NN/ACTCTACCGGCAATCGCGTC
dcProbe5-AF488IDT/5Alex488N/GAGTGTCGCGCAACTTAGCG
dcProbe5-Cy3IDT/5Cy3/ACGTCTGCGTACCGGCTTAG
dcProbe5-ATTO647NIDT/5ATTO647NN/CATGCGATTAACCGCGACTG
dcProbe6-AF488_2IDT/5Alex488N/CTTGCGGCGACAGTCGAACA
dcProbe6-Cy3IDT/5Cy3/TCGTAACCCGTGCGAAGTGC
dcProbe6-ATTO647NIDT/5ATTO647NN/CTCTCGTAGCGTGCGATGAG
dcProbe7-AF488_2IDT/5Alex488N/TTAGGTCGCCTACCGACTGC
dcProbe7-Cy3IDT/5Cy3/GCCACATCGACTCGGTCTAT
dcProbe7-ATTO647NIDTGCTCAGCCGGACGAGTAGAT/3ATTO647NN/

Before start
Prepare fresh frozen tissue sections at 10um thickness on coverslips. Store the sections in -80C and transfer on dry ice upon the start of the protocol.

Make sure that the padlock probes have 5' phosphate. The enzymatic production of padlock probes (accompanying protocol) leaves a 5' phosphate. If probes are individually synthesized without 5' phosphate, run T4 PNK reaction and clean up the product using Zymo ssDNA/RNA clean up columns.
Preparation
10m
Wash, dry and UV the silicone isolators. UV the EasyDip jars. Move away unused stuff from the bench. Wipe the working area by 70% ethanol and RNase Zap. Set the HybEZ oven 37 °C .

Prepare two jars of DEPC-1xPBST and keep one at 4 °C .

ComponentVolume (ml)
10x PBS8
10% Tween-200.8
DEPC-H2O72

Fixation
Prepare 80ml of 4% formaldehyde in 1x PBS. Store at 4 °C for use in the same day.
ComponentVolume (ml)
DEPC-water52
16% PFA20
10X PBS8


Take the tissue sections that are on 25mm*60mm coverslips out of-80 °C freezer, put them on dry ice, quickly insert them into the EasyDip slide holder, submerge the slide holder in the staining jar containing 4% PFA in PBS. Fix for 01:00:00 at 4 °C .
01:00:00 4C
2h
Remove the DEPC-PBST jar and the 4% PFA jar containing the samples from 4C. Insert the sample holder into the cold 1x PBST jar. Incubate for 3 minutes. Then insert the sample holder in the room temperature 1x PBST jar. Incubate for 3 minutes.
00:03:00 in 4C DEPC-PBST with occasional agitation
00:03:00 in RT DEPC-PBST with occasional agitation
6m
dehydration and mounting
20m
Prepare jars of 50%, 70% and two 100% ethanol. Dehydrate tissue sections with
00:05:00 50% EtOH at room temperature
00:05:00 70% EtOH at room temperature
00:05:00 100% EtOH at room temperature
00:05:00 100% EtOH at room temperature
20m
Take the coverslips out of the sample holder.
00:05:00 Air drying at room temperature.
In the meantime, put 20mm diameter Press-To-Seal silicone isolators on a kipwipe on a flat surface. Carefully put the coverslips on silicone isolators, with the tissue sample in the hole. Gently press on the back of the coverslip to seal completely. Attach another 20mm diameter isolator on top of the already mounted 20mm isolator to increase the volume.
5m
permeabilization
10m
Permeabilize the tissue section with 0.25% Triton X-100 in DEPC-1X PBS
00:10:00 at Room temperature
Component1x volume (ul)
10X PBS40
DEPC-H2O350
RNase inhibitor (enzymatics) (40U/ul)2
10% Triton X-10010
SUPERase In (20U/ul)1

Wash thrice with cold PBSTR and cold DEPC-Water
200 µL PBSTR for 00:03:00
200 µL PBSTR for 00:03:00
1 mL DEPC-water quick wash
6m
pepsin digestion
10m
Digest with 0.01% Pepsin in 0.1N HCl. Pre-warm the pepsin to 37 °C for at least 5 minutes before use.
100 µL 0.01% Pepsin in 0.1N HCl for00:01:30 at 37 °C
Component1x volume (ul)
1% pepsin1
0.1N HCl99

1m 30s
Wash two times with cold PBSTR00:00:00 200 µL PBSTR for 00:03:00

3m
reverse transcription
15m
Prepare Reverse Transcription Mix on Ice.
Component1x volume (ul)
DEPC-H2O88.125
Acr_dc10-Cy5_N9 (100uM)3.75
Acr_dc7-488_dT20 (100uM)3.75
5X SSIV Buffer30
0.1 M DTT7.5
10 mM dNTP3.75
4 mM aminoallyl-dUTP1.5
RNase Inhibitor (enzymatics, 40U/ul)3.75
Superase In (20U/ul)0.375
SuperScript IV Reverse Transcriptase7.5
Incubate tissue sections with the Reverse Transcription Mix
150 µL Reverse Transcription Mix for 00:10:00 at 4 °C then Overnight at 37 °C
Make sure to fully cover the silicone well. If you use a coverslip, do not press on it and do not let the coverslip come in contact with the reagents inside the well.
15m
Wash two times with cold PBSTR
200 µL PBSTR quick wash
200 µL PBSTR quick wash
cDNA crosslinking and gel embedding
1h 30m
Treat the sample with Acryloyl-X mix:
Component1x volume (ul)
10X PBS50
10mg/mL Acryloyl-X, SE in DMSO10
ultrapure water440
add 500 µL Acryloyl-X Mix to the sample and incubate for 00:30:00 at Room temperature

quick wash with PBSTR
400 µL PBSTR quick wash
30m
Incubate the sample with 300 µL Acrylamide Solution for 00:30:00 at Room temperature .
Prepare Acrylamide Solution.
Component1x volume (ul)
10X PBS50
40% Acrylamide/Bis (37:1)50
SUPERase-In RNase inhibitor(20U/uL)1.25
Enzymatic RNase inhibitor2.5
ultrapure water400
In the mean time prepare 5% TEMED: 5 µL TEMED in 95 µL ultrapure water
Prepare 4% APS: 10 mg Ammonium Persulfate in 250 µL ultrapure water
RNaseZap and UV 18mm coverslips and treat them with Gel-Slick.

30m
Prepare the polymerization mix and mix well by gently pipetting up and down.
Note: Be quick at this step
Component1x volume (uL)
Acrylamide solution138
4% APS6
5% TEMED6
Aspirate the acrylamide solution and add 30 µL Polymerization Mix to the sample and immediately cover with Gel-Slick-treated coverslip for 00:30:00 at Room temperature in a dark Argon chamber.

Wash with 1x PBST for 3min twice
1 mL 1X PBST for 00:03:00
1 mL 1X PBST for 00:03:00

Carefully remove the Gel-Slick-treated coverslip on the samples using a needle
Wash with 1xPBST for 3min twice
1 mL 1X PBST for 00:03:00
1 mL 1X PBST for 00:03:00
42m
RNase digestion
1h
Prepare RNase Digestion Mix

Component1x volume (ul)
ultrapure water168
10X RNase H buffer20
RNase H (5U/uL)10
RNase Cocktail2

Add 200 µL RNase Digestion Mix
Incubate at 37 °C for 01:00:00 . Cover the silicone wells.
1h
Wash samples with 1X PBS twice.
1 mL 1X PBS for 00:03:00
1 mL 1X PBS for 00:03:00
6m
padlock probe hybridization
33m
Prepare the padlock-probe-hybridization mix according to the table below. Preheat the probe-water mix to 85 °C for 00:03:00 and immediately move them to a cold block or on ice. Then complete the padlock-probe-hybridization mix.

Note: Adjust the volume and ultrapure water and padlock probes so that the final concentration of padlock probes is at 100 nM for the brain probe set and 180 nM for the kidney probe set

padlock-probe-hybridization mix
Component1x volume (ul)
ultrapure water93.1
10X Ampligase buffer15
padlock probes ( 22.9 ng/uL)31.9
100nM PLP1 oligos1.5
Ampligase (5U/uL)10

add 150 µL padlock-probe-hybridization mix to tissue sections
3m
Incubate samples in the padlock-probe-hybridization mix at 37 °C for 00:30:00 , then at 55 °C Overnight .
For the overnight incubation, first set the Ez hyb oven to 60 °C and then change it to 55 °C as you put the samples in. Cover the sample well so that the tissue sections won't dry out overnight.
30m
Wash samples with 1x PBS twice.
1 mL 1X PBS for 00:03:00
1 mL 1X PBS for 00:03:00
6m
RCA
6h
Prepare RCA Primer Mix
Component1x volume (ul)
ultrapure water119
20X SSC20
formamide60
100 uM rca_primer 1
add 200 µL RCA Primer Mix to each sample and incubate at 37 °C for 01:00:00

1h
Wash samples with 2xSSC.
1 mL 2X SSC for 00:03:00
1 mL 2X SSC for 00:03:00
6m
Prepare RCA Enzyme Mix on ice.
Component1x volume (ul)
ultrapure water119.25
10X Phi29 polymerase buffer15
10mM dNTP3.75
4mM aminoallyl-dUTP1.5
NEB BSA (20mg/mL)7.5
ThermoFisher Phi29 polymerase3
Add 150 µL RCA Enzyme Mix to each sample
Incubate samples in RCA Enzyme Mix at 30 °C for 07:00:00

7h
Wash samples with 1x PBS twice.
1 mL 1X PBS for 00:03:00
1 mL 1X PBS for 00:03:00
6m
rolony crosslinking
Add the crosslinking mix to crosslink rolonies with BS(PEG)9. Prepare crosslinking mix.

Component1x volume (ul)
250mM BS(PEG)910
10X PBS50
ultrapure water440

Crosslink rolonies with BS(PEG)9
500 µL 5 mM BS(PEG)9 in PBS for 01:00:00 at Room temperature

Wash with PBS twice
1 mL 1x PBS quick wash
1 mL 1x PBS quick wash

Quench unreacted crosslinker with 1M Tris, pH 8.0
1 mL 1M Tris pH8.0 for 00:30:00 at Room temperature

Wash with PBS twice
1 mL 1x PBS quick wash
1 mL 1x PBS quick wash
1h 30m
imaging
11m
stain the sample with Probe Hybridization Mix with decoding probes (Take dcProbe0_AF488, dcProbe0_Cy3, dcProbe0_ATTO647N probes as an example).

Prepare Probe Hybridization Mix
Component1x volume (ul)
100 uM dcProbe0_AF4881
100 uM dcProbe0_Cy31
100 uM dcProbe0_ATTO647N1
100% formamide60
20X SSC20
ultrapure water117

add 200 µL Probe Hybridization Mix to each sample. Incubate for 00:10:00 at Room temperature

10m
Wash with washing buffer (10% formamide in 2X SSC, 0.1% TritonX-100) twice. Then, image sample in imaging buffer (10% formamide in 2x SSC buffer).
1 mL washing buffer for 00:02:00
1 mL washing buffer for 00:02:00

4m
Strip with 1 mL 80% formamide in 2X SSC for 00:05:00 .
Wash with 1 mL 2X washing buffer twice.
Repeat the decoding imaging with the next set of decoding probes (dcProbe1, dcProbe2, dcProbe3, dcProbe4, dcProbe5).

5m
After images of samples stained with dcProbe0, 1, 2, 3, 4, 5 were taken, take the nuclei staining images with Draq5 staining.

add 500 µL 5 uM DRAQ5 solution to the sample. Incubate for 00:10:00 at Room temperature

wash the sample with 1x PBS twice. Then, image.
1 mL 1X PBS for 00:02:00
1 mL 1X PBS for 00:02:00

14m