Oct 27, 2020

Public workspaceDAb-seq: Single-Cell DNA and Antibody Sequencing V.2

DAb-seq: Single-Cell DNA and Antibody Sequencing
  • Ben Demaree1,2,
  • Cyrille Delley1,
  • Harish N. Vasudevan3,
  • Cheryl A.C. Peretz4,
  • David Ruff5,
  • Catherine C. Smith4,
  • Adam R Abate1,2,6
  • 1Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, San Francisco;
  • 2UC Berkeley-UCSF Graduate Program in Bioengineering, University of California, San Francisco;
  • 3Department of Radiation Oncology, University of California, San Francisco;
  • 4Division of Hematology/Oncology, Department of Medicine, University of California, San Francisco;
  • 5Mission Bio, Inc.;
  • 6Chan Zuckerberg Biohub
  • Ben Demaree: Equal contribution;
  • Cyrille Delley: Equal contribution;
  • Adam R Abate: Corresponding Author;
Icon indicating open access to content
QR code linking to this content
Protocol CitationBen Demaree, Cyrille Delley, Harish N. Vasudevan, Cheryl A.C. Peretz, David Ruff, Catherine C. Smith, Adam R Abate 2020. DAb-seq: Single-Cell DNA and Antibody Sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.bn4ymgxwVersion created by Benjamin Demaree
Manuscript citation:
Demaree, B., Delley, C.L., Vasudevan, H.N. et al. Joint profiling of DNA and proteins in single cells to dissect genotype-phenotype associations in leukemia. Nat Commun 12, 1583 (2021). https://doi.org/10.1038/s41467-021-21810-3
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Created: October 27, 2020
Last Modified: October 27, 2020
Protocol Integer ID: 43896
Keywords: single-cell, DNA sequencing, acute myeloid leukemia, droplet microfluidics, multiomics, antibody sequencing studies of acute myeloid leukemia, heterogeneity of leukemia, tumor heterogeneity complicates integration of dna variant, acute myeloid leukemia, cell surface phenotype from single cell, blast cell genotype, leukemia, immunophenotypes from separate measurement, antibody sequencing study, flow cytometry as primary tool, single cell, flow cytometry, dna genotype, tumor heterogeneity complicates integration, immunophenotype, cell surface phenotype, cell dna, dna variant, phenotype dynamic, direct profiling of proteogenomic state, complex genotype
Abstract
Studies of acute myeloid leukemia rely on DNA sequencing and immunophenotyping by flow cytometry as primary tools for disease characterization. However, leukemia tumor heterogeneity complicates integration of DNA variants and immunophenotypes from separate measurements. Here we introduce DAb-seq, a novel technology for simultaneous capture of DNA genotype and cell surface phenotype from single cells at high throughput, enabling direct profiling of proteogenomic states in tens of thousands of cells. To demonstrate the approach, we analyze the disease of three patients with leukemia over multiple treatment timepoints and disease recurrences. We observe complex genotype-phenotype dynamics that illustrate the subtlety of the disease process and the degree of incongruity between blast cell genotype and phenotype in different clinical scenarios. Our results highlight the importance of combined single-cell DNA and protein measurements to fully characterize the heterogeneity of leukemia.

Graphical overview of the DAb-seq protocol.

Guidelines
This protocol is compatible with Mission Bio V1 chemistry only.
Materials
Antibody conjugation reagents and supplies

  • D-PBS
  • Monoclonal antibodies (various suppliers)
  • DBCO-PEG5-NHS Ester linker (Click Chemistry Tools, cat. no. A102P)
  • Amicon 50 kDa filter (Millipore Sigma, cat. no. UFC505024)
  • Agilent Bioanalyzer Protein 230 Kit

DAb-seq workflow reagents and supplies

  • PBS-F (D-PBS + 5% FBS)
  • 5 mL DNA LoBind tubes (Eppendorf, cat. no. 0030108310)
  • Human TruStain FcX (BioLegend, cat. no. 422301)
  • Dextran sulfate (Research Products International, cat. no. D20020)
  • Salmon sperm DNA (Invitrogen, cat. no. 15632011)
  • Mission Bio Tapestri instrument and AML kit
  • Ampure XP beads (Beckman Coulter, cat. no. A63881)
  • Dynabeads MyOne Streptavidin C1 beads (Thermo Fisher, cat. no. 65001)
  • Agilent Bioanalyzer High Sensitivity DNA Kit
  • Sequencing kit (Illumina)
Conjugation of antibodies to oligonucleotide barcodes
1d
Resuspend each monoclonal antibody to Amount100 µg in Amount100 µL PBS.

Note
Antibody must be ordered in protein-free, azide-free buffer, preferably plain PBS. Resuspended from lyophilized stock with trace amounts of trehalose (e.g. from R&D Systems) is also acceptable. For a list of antibodies used in the DAb-seq publication, see Supplemental Table 2 attachment.

Prepare Concentration25 millimolar (mM) DBCO/PEG/NHS linker in DMSO. After adding DMSO, vortex at TemperatureRoom temperature for Duration00:10:00 to allow linker to dissolve completely.

Note
For long-term storage, aliquot DBCO linker in Amount5 µL volumes and store at Temperature-20 °C .

10m
Dilute DBCO linker toConcentration2.5 millimolar (mM) in water.

To each 100 uL antibody solution, add Amount1.07 µL of 2.5 mM DBCO linker. Pipet up and down to mix.

Incubate linker/antibody solution for Duration02:00:00 at TemperatureRoom temperature .

2h
Add Amount400 µL PBS to linker/antibody solution and transfer to 50 kDA Amicon filter.

Centrifuge Centrifigation14000 x g, 00:10:00 . Discard flow-through.

Add Amount180 µL PBS to filter and invert filter in new collection tube. Centrifuge Centrifigation1500 x g, 00:05:00 to elute.

Resuspend lyophilized oligonucleotide to Concentration200 micromolar (µM) in PBS.

Note
Oligos must have 5’ azide group (IDT code: /5AzideN/) and be HPLC-purified. For full oligo sequence, including barcodes, see Supplemental Table 2 attachment.

Add Amount6.67 µL oligo to the approximately Amount200 µL of filtered antibody solution.

Incubate at Temperature4 °C DurationOvernight .
Note
16-20 h is an acceptable incubation time.


2h
Add Amount300 µL PBS to antibody-oligo conjugate and transfer to 50 kDa Amicon filter.

Centrifuge Centrifigation14000 x g, 00:10:00 . Discard flow-through.
Repeat Step 13 two additional times, adding Amount500 µL PBS for each wash. This is a total of three washes.

Add Amount30 µL PBS to filter and invert filter in new collection tube. Centrifuge Centrifigation1500 x g, 00:05:00 to elute.
Collect ~50 uL eluant and store in Protein LoBind tube at Temperature4 °C .
Verify conjugation using a Bioanalyzer Protein 230 kit or equivalent gel electrophoretic assay. A representative Bioanalyzer Protein 230 trace is shown below. A peak representing the unconjugated antibody is visible at ~155 kDa. Larger peaks represent antibodies conjugated to one, two, or more oligos.
Representative Bioanalyzer Protein 230 trace for oligo-antibody conjugate. Non-denaturing conditions were used in this run.

Staining cells
1d
Collect cells from culture or thaw from frozen according to cell-specific protocols. Resuspend cells in 5-10 mL PBS-F (D-PBS + 5% FBS) and count. It is highly recommended to measure cell viability with trypan blue or other exclusion assay.
Note
Cells should be >90% viable before staining to ensure minimal cell loss during the washing steps.

Spin down 2 million cells in a 15 mL DNA LoBind tube for Centrifigation400 x g, 00:04:00 . Aspirate the supernatant and resuspend the cell pellet in Amount180 µL PBS-F.
Note
It is helpful to grate the tube gently against the TC hood to loosen the cell pellet prior to the addition of buffer.


Add Amount10 µL BioLegend Human TruStain FcX blocking solution, Amount4 µL of a Concentration1 % (m/v) dextran sulfate solution, and Amount4 µL of Concentration10 mg/mL salmon sperm DNA. Pipet gently to mix.

Incubate Duration00:10:00 TemperatureOn ice .

10m
Add Amount0.5 µg of each antibody-oligo conjugate and incubate Duration00:30:00 TemperatureOn ice .

30m
Perform five washes to remove excess unbound antibody. For each wash, add Amount5 mL PBS-F to the tube and centrifuge Centrifigation400 x g, 00:04:00 .

After final wash, resuspend cells in Mission Bio Cell Buffer at a final concentration of 3M cells/mL.
Cell encapsulation and barcoding on the Tapestri instrument
1d
Follow cell encapsulation and barcoding procedure as described in the attached Mission Bio document: "Tapestri Single-Cell DNA AML User Guide".
Note
Follow sections "Encapsulate Cells" (page 18) through "UV Treatment and Targeted PCR Amplification" (page 31). The DAb-seq protocol for these sections are unchanged from the conventional DNA-only workflow.

Cleanup barcoded DNA and antibody products
Perform Steps 6.1 through 6.7 in the attached Mission Bio protocol. DO NOT discard the Ampure XP supernatant in Step 6.8, as this contains the short antibody tags. Instead, for each tube, transfer the supernatant to a new 1.5 mL DNA LoBind tube.
Critical
Finish DNA library cleanup as described in the Mission Bio protocol. Elute in 30 uL water and use a Qubit hsDNA assay to measure the concentration of barcoded DNA product in each tube. Transfer the DNA product to PCR tubes and store at Temperature-20 °C prior to library PCR.
Expected result
Typical concentrations are between 0.5 and 2.0 ng/μl.


For antibody tag cleanup, add biotinylated capture oligonucleotide to the tube supernatants from Step 26 to a final concentration of Concentration0.6 micromolar (µM) .

Note
The capture probe sequence is /5Biosg/GGCTTGTTGTGATTCGACGA/3C6/, using IDT codes.

Heat the supernatant-probe solution to Temperature95 °C for Duration00:05:00 to denature the PCR product, then snap cool on ice for probe hybridization. Allow tubes to cool for Duration00:05:00 on ice.

10m
For each sample tube, wash Amount10 µL of magnetic streptavidin beads two times in Amount1 mL D-PBS, allowing beads to bind to the magnet between washes. Resuspend beads in Amount10 µL D-PBS and add to each tube. Pipet to mix.

Incubate tubes Duration00:15:00 at TemperatureRoom temperature with rotation to allow streptavidin-biotin binding.



15m
Place the tubes on a magnet and allow beads to separate.
Wash beads two times in Amount1 mL D-PBS and resuspend in 30 μL water. Transfer the bead solutions to PCR tubes and store at Temperature-20 °C prior to library PCR.

Library preparation PCR
PrepareAmount50 µL library PCR reactions for each tube, and for each of the DNA and antibody tag libraries:

DNA panel libraries:

  • Amount25 µL Mission Bio Barcoding Mix
  • Amount5 µL P5 primer (Concentration4 micromolar (µM) )
  • Amount5 µL P7 primer (Concentration4 micromolar (µM) ) - DNA panel specific
  • Amount4 ng of barcoded DNA product in Amount15 µL water


Antibody tag libraries:

  • Amount25 µL Mission Bio Barcoding Mix
  • Amount5 µL P5 primer (Concentration4 micromolar (µM) )
  • Amount5 µL P7 primer (Concentration4 micromolar (µM) ) - Antibody tag specific
  • Amount15 µL bead-bound antibody tag product
Note
Ensure all combinations of DNA panel and antibody tag libraries have unique P5 and P7 barcodes. The DNA panel and antibody tag libraries have different P7 primers, which are listed in the attachment "Supplementary Table 6: Library preparation primer sequences".


Amplify the DNA panel and antibody tag libraries according to the following protocol, using 10 cycles for the DNA panel and 20 cycles for the antibody tags.

Library preparation PCR protocol.

Library cleanup and quantification
Perform library cleanup for both the DNA panel and antibody tag libraries as described in the attached Mission Bio document (Steps 7.10 to 7.25): "Tapestri Single-Cell DNA AML User Guide". In Step 7.13, use Amount35 µL Ampure XP beads instead of Amount31.5 µL .

Quantify the concentration of DNA panel and antibody tag libraries using the Qubit hsDNA assay.

Expected result
Typical concentrations are between 5 and 20 ng/uL.


Run Amount1 ng of each library on a Bioanalyzer High-Sensitivity DNA chip or comparable TapeStation assay.
Expected result
All libraries should be free of primer-dimers (<80 bp). The antibody tag library fragment should appear as a sharp peak around 250 bp. For the DNA panel libraries, the fragments should be distributed between 400 and 500 bp.

Representative DNA panel library, run on a Bioanalyzer High-Sensitivity DNA chip.
Representative antibody tag library, run on a Bioanalyzer High-Sensitivity DNA chip.

Next-generation sequencing
Pool the libraries for sequencing, the protocol for which varies depending on Illumina sequencing platform. It is most cost-effective to sequence the DNA panel and antibody libraries using separate kits, as the antibody tags require fewer cycles (~80 cycles for antibody tags vs. 300 for DNA panel). A custom Read 1 primer is required in both libraries (see note below).

The amount of reads to allot for each library depends on the number of cells sequenced and number of targets in the DNA and antibody panels. As a rule of thumb, allotting 100X coverage for each DNA and antibody target per cell should yield sufficient depth for genotyping and antibody tag counting.
Note
Mission Bio V1 chemistry requires a custom Read 1 primer with the following sequence: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG. It should be HPLC purified.

Data processing
The raw FASTQ files are analyzed by the DAb-seq pipeline available at: https://github.com/AbateLab/DAb-seq. See the README for detailed instructions on setting up and running the pipeline.