Sep 02, 2024
Version 2
CUT&RUN abbreviated protocol v2 V.2
Version 1 is forked from CUT&RUN: Targeted in situ genome-wide profiling with high efficiency for low cell numbers
- CG -1
- 1-
- Human Cell Atlas Method Development Community
- Low-cost, high-quality ...
Protocol Citation: CG - 2024. CUT&RUN abbreviated protocol v2. protocols.io https://dx.doi.org/10.17504/protocols.io.8epv5rzo4g1b/v2Version created by CG -
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 19, 2019
Last Modified: September 02, 2024
Protocol Integer ID: 106806
Keywords: chromatin profiling, epigenomics
Abstract
An abbreviated version of Henikoff/Janssens Cut&RUN protocol. We use in-house prepared pAG-MNase and standard conditions. If library quality is poor, consider using one of the high-salt or low-salt conditions offered in the original protocol.
Guidelines
The protocol workflow is as follows:
Day 1, Cells to DNA
Binding cells to beads (Steps 1-8, 30 min)
Permeabilize cells and bind primary antibodies (Steps 9-13, 2.5 hr–overnight, longer incubations provide higher yields)
Bind secondary antibody as required (Steps 14-20, 15 min-1.5 hr)
Bind Protein A-MNase or Protein A/G-MNase fusion protein (Steps 21-26, 1.5 hr)
Chromatin Digestion and Release: Standard CUT&RUN (Steps 27-37, 1.5 hr)
Phenol Chloroform Extraction (Steps 57-67, 1.5 hr)
Days 2-4, Library preparation and sequencing
Sample Analysis Pre-Library Prep (optional) (Steps 68-69, 1 hr)
End Repair and Adapter Ligation (Steps 70-78, 3 hr–overnight)
PCR Enrichment of CUT&RUN Libraries (Steps 79-109, 2-3 hr)
CUT&RUN Library Analysis and Sequencing (Steps 110-112, variable timing)
Day 5
Data processing and analysis (Steps 113-114, variable timing)
Figure 1: CUT&RUN workflow. A schematic overview of the CUT&RUN protocol. Cells are harvested and bound to concanavalin A-coated magnetic beads. Cell membranes are permeabilized with digitonin to allow the specific antibody to find it's targets. Afer incubation with antibody, beads are briefly washed, and then incubated with pA- or pA/G-MNase. The user then selects one of three different options for the MNase digestion reaction to best fit the needs of their experiment. The first option for digestion is the same as the previously released CUT&RUN protocol, and is refered to as standard CUT&RUN. The second option includes high Ca2+ to compact chromatin and hold it in place during digestion, limiting the amount of MNase that is able to freely diffuse, and reducing the background for targets that are enriched at active chromatin (e.g. H3K27ac). The third option is for direct ligation of Illumina-compatible adapters to the cleaved chromatin, avoiding the DNA puritification steps that are required for options 1 and 2. Regardless of the digestion option that is selected, cells are first chilled to 0 °C, and digestion begins upon addition of Ca2+. Reactions are stopped by chelating away the calcium and the DNA fragments released into solution by cleavage are used to prepare CUT&RUN sequencing libraries.
EQUIPMENT
- Centrifuge Eppendorf 5810, swinging bucket
- Centrifuge Eppendorf 5424, fixed angle rotor
- Centrifuge Eppendorf 5415R, refrigerated fixed angle rotor
- Macsimag magnetic separator (Miltenyi, cat. no. 130-092-168), which allows clean withdrawal of the liquid from the bottom of 1.7 and 2 ml microfuge tubes.
- Vortex mixer (e.g., VWR Vortex Genie)
- Micro-centrifuge (e.g., VWR Model V)
- 1.5-ml microcentrifuge tubes (Genesee, cat. no. 22-282)
- 2-ml microcentrifuge tubes (Axygen, cat. no. MCT-200-C)
- Tube rotator (Labquake, Thermo Fisher)
- Heater block with wells for 1.5-ml microcentrifuge tubes
- Water baths (set to 37°C and 70 °C)
- MaXtract phase-lock microcentrifuge tubes (Qiagen, cat. no. 139046)
- Capillary electrophoresis instrument (e.g. Agilent Tapestation 4200)
- Qubit Fluorometer (Life Technologies, cat. no. Q33216)
INTRODUCTION
Experimental Design
The CUT&RUN method for the in situ targeted cleavage and release of chromatin complexes is straightforward and can be completed in under a day using standard lab equipment. Here we provide a detailed CUT&RUN protocol that now includes various optional modifications to the MNase digestion reaction that can be used to improve data quality or increase throughput in specific situations. One of the strengths of CUT&RUN is that the entire reaction is performed in situ, whereby the antibody and pA- or pA/G-MNase are free to diffuse into the nucleus. The original protocol used nuclei prepared by a combination of hypotonic lysis and treatment of cells with Triton X-100. This has been successful with a number of cell lines, but we have recently adapted the protocol to use cells permeabilized by the non-ionic detergent digitonin, which has been successfully used in other in situ methods, including ChEC-seq and ATAC-seq. Digitonin partitions into membranes and extracts cholesterol. Membranes that lack cholesterol are minimally impacted by digitonin. Nuclear envelopes are relatively devoid of cholesterol compared to plasma membranes. As such, treatment of cells with digitonin represents a robust method for permeabilizing cells without compromising nuclear integrity. The protocol described here uses digitonin, but it is possible that individual experimental situations call for generating intact nuclei by other means, and such nuclei can be prepared by a suitable method, bound to concanavalin A-coated beads as per the protocol provided in Skene and Henikoff (eLife, 2017), and then enter the protocol below at step 9.
One of the limitations of a protocol that has inherently low background and is amenable to low cell numbers is that the amount of DNA recovered can be very low, such that analysis even by sensitive capillary electrophoresis or picogreen assays (e.g. Agilent Tapestation and Qubit) are problematic. In addition, high resolution mapping techniques that cleave a minimal footprint are not suitable to PCR-based analysis of known binding loci, as it is not commonly possible to design ~50 bp PCR amplicons. As such, we recommend using a positive control antibody that targets an abundant epitope and therefore the DNA can be readily detected. We have successfully used a rabbit monoclonal antibody raised against H3K27me3, with capillary electrophoresis showing with the amount of cleaved fragments being proportional to the number of starting cells. A nucleosomal ladder is expected by Tapestation or other sensitive electrophoretic analysis method (Fig. 2), and the use of a monoclonal antibody avoids potential lot-to-lot variation that can complicate troubleshooting. For less abundant epitopes, including many transcription factors, it is harder to detect the cleaved fragments by even sensitive electrophoretic analysis (Supplementary Figure 1). Once the expected digested DNA pattern is observed for the positive control by capillary electrophoresis such as H3K27me3, it is not necessary to sequence this sample. As a negative control, we recommend the use of a non-specific rabbit IgG antibody that will randomly coat the chromatin at low efficiency without sequence bias. We do not recommend a no-antibody control, as the lack of tethering increases the possibility that slight carry-over of pA-MNase will result in preferential fragmentation of hyper-accessible DNA.
In our previously published study, we showed that targeted cleavage occurred within seconds of adding Ca2+ ions, and by virtue of being a sterically regulated tethered reaction, the cleavage pattern was constant over time. However, longer digestion times release more material with no apparent change in the signal-to-noise ratio (Supplementary Figure 2). We therefore recommend digesting for 30 minutes as a starting point that can be tailored based upon epitope abundance and antibody concentration.
Limitations
As is the case with ChIP, the success of CUT&RUN depends in large part on the affinity of the antibody for its target and its specificity under the conditions used for binding. Because antibodies bind to their epitopes in the solid state using CUT&RUN, we would expect that antibodies successfully tested for specificity by immunofluorescence (IF) would be likely to work with CUT&RUN, with the caveat that IF generally involves fixation, whereas formaldehyde fixation decreases the efficiency of CUT&RUN.
In the standard CUT&RUN protocol we recommend allowing the cleaved chromatin complexes to diffuse out of the nuclei, thereby permitting simple isolation of the cut DNA from the supernatant fraction with the undigested genome retained in the intact nuclei. However, it is possible that a chromatin complex is too large to diffuse out or that protein-protein interactions retain the cleaved complex. In such cases, total DNA may be extracted after the digestion. By doing a very simple negative size selection using paramagnetic carboxylated beads (e.g. Agencourt AMPure XP beads) large genomic DNA can be removed prior to preparing CUT&RUN sequencing libraries. In Skene and Henikoff (eLife, 2017) we showed that this strategy was successful for the ~1 MDa yeast RSC complex.
TROUBLESHOOTING
Materials
MATERIALS
10 mM Adenosine 5-Triphosphate (ATP)New England BiolabsCatalog #PO756S
Cell suspension. We have used human K562 cells, Drosophila S2 cells and dissected Drosophila tissues such as brains and imaginal disks, and spheroplasted yeast.
Concanavalin-coated magnetic beads Bangs LaboratoriesCatalog #BP531
Antibody to an epitope of interest. For example, rabbit α-CTCF polyclonal antibody (Millipore 07-729) for mapping 1D and 3D interactions by CUT&RUN
Positive control antibody to an abundant epitope, e.g. α-H3K27me3 rabbit monoclonal antibody (Cell Signaling Technology, cat. no. 9733)
Negative control antibody to an absent epitope, e.g. guinea pig α-rabbit antibody
5% Digitonin Emd MilliporeCatalog #300410
Spike-in DNA (e.g., from Saccharomyces cerevisiae micrococcal nuclease-treated chromatin, provided by authors upon request)
Distilled, deionized or RNAse-free H2O (dH2O e.g., Promega, cat. no. P1197)PromegaCatalog #P1197
1 M Manganese Chloride (MnCl2)Sigma AldrichCatalog #203734
1 M Calcium Chloride (CaCl2)Fisher ScientificCatalog #BP510
1 M Potassium Chloride (KCl)Sigma AldrichCatalog #P3911
1 M Hydroxyethyl piperazineethanesulfonic acid pH 7.5 (HEPES (Na ))Sigma AldrichCatalog #H3375
5 M Sodium chloride (NaCl)Sigma AldrichCatalog #S5150-1L
0.5 M Ethylenediaminetetraacetic acid (EDTA)Research OrganicsCatalog #3002E
0.2 M Ethylene glycol-bis(β-aminoethyl ether)-N,N,N,N-tetraacetic acid (EGTA)Sigma AldrichCatalog #E3889
Roche Complete Protease Inhibitor EDTA-Free tablets Sigma AldrichCatalog #5056489001
RNase A, DNase and protease-free (10 mg/ml)Thermo Fisher ScientificCatalog #EN0531
Agencourt AMPure XP magnetic beads Beckman CoulterCatalog #A63880
10% Sodium dodecyl sulfate (SDS)Sigma AldrichCatalog #L4509
Proteinase KThermo Fisher ScientificCatalog #EO0492
Phenol-chloroform-isoamyl alcohol 25:24:1 (PCI)Invitrogen - Thermo FisherCatalog #15593049
ChloroformSigmaCatalog #366919-1L
1 M Tris-HCl pH 8.0
Ethanol Decon LabsCatalog #2716
Qubit dsDNA HS kit Life TechnologiesCatalog #Q32851
10mM dNTPsKapa BiosystemsCatalog #KK1017
T4 Polynucleotide Kinase - 500 unitsNew England BiolabsCatalog #M0201S
T4 DNA polymerseInvitrogen - Thermo FisherCatalog #18005025
Taq DNA polymeraseThermo ScientificCatalog #EP0401
2X Rapid ligase bufferCatalog #B101L
Enzymatics DNA ligaseCatalog #L6030-HC-L
5X KAPA bufferKapa BiosystemsCatalog #KK2502
KAPA HS HIFI polymeraseKapa BiosystemsCatalog #KK2502
10X NEB T4 DNA ligase bufferNew England Biolabs
40% PEG 4000Sigma-aldrichCatalog #81242
40% PEG 8000Sigma-aldrichCatalog #202452
Protein A/G–Micrococcal Nuclease (pA/G-MNase) fusion protein (plasmid for protein prep available from Addgene ID:123461). Store in 50% glycerol at -20 oC.addgeneCatalog #123461
Protein A–Micrococcal Nuclease (pA-MNase) fusion protein (plasmid for protein prep available from Addgene ID: 86973). Store in 50% glycerol at -20 oC.
20 mg/ml GlycogenSigma AldrichCatalog #10930193001
5g Spermidine (mix up to 17.2 mL in water to make 2M stock and store @ -20 oC)Sigma AldrichCatalog ##S0266-5G
In this protocol we provide an optional library prep strategy for Illumina sequencing that uses TruSeq-Y Adapters with a free 3'T overhang. Alternatively, many users have also had success with the NEBNext Ultra I DNA Library Kit (E7645) following a protocl developed by Nan Liu in Stuart Orkin's lab (dx.doi.org/10.17504/protocols.io.wvgfe3w). To follow the library prep protocol described here the following oligos can be ordered from any company that provides custom oligo synthesis (e.g. IDT or Sigma-Aldrich):
TruSeq Universal Adapter (PAGE purification):
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T
TruSeq Indexed Adapters (PAGE purification):
P-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC(INDEX)ATCTCGTATGCCGTCTTCTGCTT*G
Adapter master stocks should be prepared by annealing the TruSeq Universal adapter to each of the TruSeq Indexed Adapters individually by mixing them at a concentration of 25 µM, and then heating them to 100 0C and allowing them to slowly cool either at RT on a bench top or in a thermocycler (1 degree per minute).
P5 primer (HPLC purification):
AATGATACGGCGACCACCGA*G
P7 primer (HPLC purification):
CAAGCAGAAGACGGCATACGA*G
(* = phosphorothioate bond; P = phosphate group; INDEX = 6 nucleotide barcode)
Before start
REAGENT SETUP
5% Digitonin To reconstitute enough digitonin for an experiment, weigh out the powder in a 2 mL microcentrifuge tube, boil water in a small beaker in a microwave oven, and pipette in and out to warm the 1000 μL pipette tip. Pipette the hot water into the tube with the digitonin powder to make 5% (w/v), close the cap and quickly vortex on full until the digitonin is completely dissolved. If refrigerated, this stock can be used within a week, but will need reheating as the digitonin slowly precipitates. The effectiveness of digitonin varies between batches, so testing permeability of Trypan blue is recommended to determine the concentration to use for a cell type. We have obtained excellent results for K562 cells with 0.02-0.1% digitonin.
- NOTE: The 5% digitonin stock may also be prepared by dissolving in dimethylsulfoxide (DMSO), and can then be stored at -20 °C for up to 6 months. Be aware that DMSO can absorb through the skin.
- CAUTION: Digitonin is toxic and care should be taken especially when weighing out the powder.
Binding buffer: Mix 20 mL of Binding Buffer in a 50 mL conical tube. Store the buffer at 4 °C for up to 6 months.
Activate Concanavalin A-coated beads in Binding Buffer: Gently resuspend and withdraw enough of the slurry such that there will be 10 μL for each final sample and/or digestion time point. Transfer into 1.5 mL Binding buffer in a 2 ml tube. Place the tube on a magnet stand to clear (30 s to 2 min). Withdraw the liquid, and remove from the magnet stand. Add 1.5 mL Binding buffer, mix by inversion or gentle pipetting, remove liquid from the cap and side with a quick pulse on a microcentrifuge. Resuspend in a volume of Binding buffer equal to the volume of bead slurry (10 μL per final sample).
Wash buffer: Mix 50 mL of Wash Buffer. This buffer can be stored at 4 °C for up to 1 week, however, Roche Complete Protease Inhibitor tablet should be added fresh on the day of use.
- NOTE: A concentration of salt that is in the physiological range avoids stress when washing the cells and mixing with beads. Spermidine in the wash buffer is intended to compensate for removal of Mg2+ during incubation in the Antibody Buffer, which might otherwise affect chromatin properties.
Dig-wash buffer: Mix 150-600 µL 5% (wt/vol) digitonin with 30 mL Wash Buffer for a final concentration of digitonin between 0.025% and 0.1% (wt/vol). Store this buffer on ice or at 4 °C for up to 1 day, and vortex before use.
- NOTE: The effectiveness of digitonin varies between batches, so testing for full permeability of Trypan blue is recommended to determine the concentration to use for a cell type. We have obtained excellent results for H1 and K562 cells with 0.05% digitonin (300 µL 5% (wt/vol) digitonin in 30 mL Wash Buffer). For simplicity, we use this same buffer for all steps starting from the incubation in primary antibody until the chromatin digestion.
Antibody buffer: Mix 8 μL 0.5 M EDTA with 2 mL Dig-wash buffer and place on ice.
- NOTE: The presence of EDTA during antibody treatment removes excess divalent cations used to activate the Concanavalin A-coated beads, as well as endogenous cations from the cells of interest. This serves to halt metabolic processes, stop endogenous DNAse activity, and prevent carry-over of Ca2+ from the Binding Buffer that might prematurely initiate strand cleavage after addition of pA-MNase. Washing out the EDTA before pA-MNase addition avoids inactivating the enzyme.
2X STOP Buffer: Mix 5 mL of 2X STOP Buffer. Store the buffer at 4 °C for up to 1 week.
Binding cells to beads (~30 min)
Binding cells to beads (~30 min)
Harvest fresh culture(s) at room temperature and count cells. The same protocol can be used for up to 500,000 mammalian cells per sample and/or digestion time point.
Centrifuge 3 min 600 x g at room temperature and withdraw liquid.
00:03:00 Centrifugation
Resuspend in 1.5 mL room temperature Wash buffer by gently pipetting and transfer if necessary to a 2 mL tube.
1.5 mL Wash buffer
Centrifuge 3 min 600 x g at room temperature and withdraw liquid.
00:03:00 Centrifugation
Repeat steps 3 and 4 two more times.
Repeat Dig-wash steps
Note
CRITICAL STEP: Thorough washing removes free sugars and other molecules that can compete for binding to the Concanavalin A coated-beads, ensuring efficient binding and recovery of the cells of interest.
Resuspend in 1 mL room temperature Wash Buffer by gently pipetting.
While gently vortexing the cells at room temperature, add the ConA-coated magnetic bead slurry.
Rotate 5-10 min at room temperature.
00:10:00 Rotation
Permeabilize cells and bind primary antibodies (2.5 hours - overnight)
Permeabilize cells and bind primary antibodies (2.5 hours - overnight)
Mix well by vigorous inversion to ensure the bead-bound cells are in a homogenous suspension and divide into aliquots in 1.5-mL tubes, one for each antibody to be used.
Note
NOTE: Some users have experienced issues with ConA beads sticking to the sides of the tube and coming out of solution during antibody incubation steps. In this case, 0.6-mL Lo-bind microcentrifuge tubes can be used, and subsequent Dig-wash volumes reduced to 300 µL. However, when bound to low cell numbers (e.g. <100K) the ConA beads will be extremely slippery on the sides of lo-bind tubes, and so great care must be taken while removing solutions on the magnet during wash steps etc. to avoid losing the sample.
Place on the magnet stand to clear and pull off the liquid.
Place each tube at a low angle on the vortex mixer set to low (~1100 rpm) and squirt 50-150 μL of the Antibody buffer per sample along the side while gently vortexing to allow the solution to dislodge most or all of the beads. Tap to dislodge the remaining beads150 µL Antibody buffer
Mix in the primary antibody to a final concentration of 1:100 or to the manufacturer’s recommended concentration for immunofluorescence.
Place on a nutator or tube rotator at room temperature for ~2 hr or at 4 °C overnight.
02:00:00 Nutator or tube rotator at RT
Bind Protein A-MNase or Protein A/G-MNase fusion protein (1.5 hours)
Bind Protein A-MNase or Protein A/G-MNase fusion protein (1.5 hours)
Remove liquid from the cap and side with a quick pulse on a micro-centrifuge. Place on the magnet stand (~30 sec) to clear and pull off all of the liquid.
00:00:30 Magnet stand
Add 1 mL Dig-Wash buffer, mix by inversion, or by gentle pipetting if clumps persist.
1 mL Dig-Wash buffer
Repeat Dig-wash steps 21-22.
Repeat Dig-wash steps
Remove liquid from the cap and side with a quick pulse on a micro-centrifuge. Place on the magnet stand to clear (~30 s) and pull off all of the liquid.
00:00:30 Magnet stand
Place each tube at a low angle on the vortex mixer set to low (~1100 rpm). Squirt 150 μL of the Protein A-MNase or Protein A/G-MNase fusion protein at 700 ng/mL (e.g., 1:200 of a 140 µg/mL glycerol stock) in Dig-wash buffer (per sample and/or digestion time point) along the side while gently vortexing to allow the solution to dislodge most or all of the beads. Tap to dislodge the remaining beads.
150 µL Protein A-MNase or Protein A/G-MNase (700 ng/mL) in Dig-wash buffer
Place on the nutator or tube rotator at 4 °C for ~1 hr.
01:00:00 Nutator or tube rotator at 4 °C
Chromatin Digestion and Release Option 1: Standard CUT&RUN (1.5 hours)
Chromatin Digestion and Release Option 1: Standard CUT&RUN (1.5 hours)
Remove liquid from the cap and side with a quick pulse on a micro-centrifuge. Place on the magnet stand (~30 s) to clear and pull off all of the liquid.
00:00:30 Magnet stand
Add 1 mL Dig-wash buffer, mix by inversion, or by gentle pipetting if clumps persist.
1 mL Dig-wash buffer
Repeat Dig-wash steps 27-28.
Repeat Dig-wash steps
Remove liquid from the cap and side with a quick pulse on a micro-centrifuge. Place on the magnet stand to clear (~30 s) and pull off all of the liquid.
00:00:30 Magnet stand
Place each tube at a low angle on the vortex mixer set to low (~1100 rpm) and add 100 μL of the Dig-wash buffer (per sample and/or digestion time point) along the side while gently vortexing to allow the solution to dislodge most or all of the beads. Tap to dislodge the remaining beads.
100 µL Dig-wash buffer (per sample or digestion time point)
Insert tubes into the 1.5 mL wells of a heater block sitting in wet ice to chill down to 0 °C.
0 °C
Remove each tube from the block, mix in 2 μL 100 mM CaCl2 (per sample and/or digestion time point), diluted 1:10 from a 1 M stock, with gentle vortexing and immediately replace the tube in the 0 °C block
2 µL 100 mM CaCl2 (per sample or digestion time point) 0 °C
Incubate at 0 °C for the desired digestion time (default is 30 min).
00:30:00 Incubation
0 °C Incubation
Add 100 μL 2X STOP Buffer and mix by gentle vortexing. When there are multiple digestion time points, remove 100 μL and add to a new tube containing 100 μL 2X STOP Buffer and mix by gentle vortexing.
100 µL 2XSTOP
Incubate 30 min @ 37 °C to release CUT&RUN fragments from the insoluble nuclear chromatin.
00:30:00 Incubation
37 °C Incubation
Place on the magnet stand to clear. Cleanly transfer the supernatant containing digested chromatin to a fresh 1.5-mL microcentrifuge tube and proceed with Phenol Chloroform Extraction (Step 57).
200 µL STOP w/ Chromatin
Phenol Chloroform Extraction (~1.5 hours)
Phenol Chloroform Extraction (~1.5 hours)
To each sample add 2 μL 10% SDS (to 0.1%), and 2.5 μL Proteinase K (20 mg/ml). Mix by inversion and incubate 1 hr @ 50 °C.
2 µL 10% SDS (to 0.1%)/sample
2.5 µL Proteinase K (20 mg/ml)/sample
50 °C Incubation
01:00:00 Incubation
Add an equal volume of Phenol Chloroform to the sample (e.g. to 200 µL sample add 200 µL Phenol Chloroform). Mix by full-speed vortexing ~2 s.
200 µL PCl
00:00:02 Vortexing
Transfer to a phase-lock tube (e.g., Qiagen MaXtract), and centrifuge 5 min, room temperature @ 16,000 x g.
00:05:00 Centrifugation
Add an equivalent volume of chloroform to the initial sample volume (e.g. for a 200 µL starting sample volume add 200 µL chloroform). Invert ~10X to mix and then centrifuge 5 min, room temperature @ 16,000 x g.
200 µL Chloroform
00:05:00 Centrifugation
Remove the top liquid phase by pipetting to a fresh tube containing 2 μL 2 mg/mL glycogen (diluted 1:10 from 20 mg/mL glycogen stock).
2 µL 2 mg/ml glycogen
Add 500 μL 100% ethanol and mix by vortexing or tube inversion.
500 µL 100% ethanol
Chill on ice and centrifuge 10 min, 4 °C @ 16,000 x g.
00:10:00 Centrifugation
4 °C Centrifugation
Pour off the liquid and drain on a paper towel.
Rinse the pellet in 1 ml 100% ethanol and centrifuge 1 min, 4 °C @ 16,000 x g.
1 mL 100% ethanol
00:01:00 Centrifugation
4 °C Centrifugation
Carefully pour off the liquid and drain on a paper towel. Air dry.
00:05:00 Air Dry
When the pellet is dry, dissolve in 30-50 μL 1 mM Tris-HCl pH 8 0.1 mM EDTA, then transfer to a new 0.6 mL Lo-Bind microcentrifuge tube.
30 µL 1 mM Tris-HCl pH 8 0.1 mM EDTA
CUT&RUN Library Analysis and Sequencing
CUT&RUN Library Analysis and Sequencing
Quantify library yield using dsDNA-specific assay, such as Qubit.
Determine the size distribution of libraries by Agilent 4200 TapeStation analysis.
Pool samples at equimolar concentrations and perform paired-end Illumina sequencing on the barcoded libraries following the manufacturer’s instructions.
Data Processing and Analysis
Data Processing and Analysis
We align paired-end reads using Bowtie2 version 2.2.5 with options: --local --very-sensitive- local --no-unal --no-mixed --no-discordant --phred33 -I 10 -X 700. For mapping spike-in fragments, we also use the --no-overlap --no-dovetail options to avoid cross-mapping of the experimental genome to that of the spike-in DNA.
Note
CRITICAL STEP: Separation of sequenced fragments into ≤120 bp and ≥150 bp size classes provides mapping of the local vicinity of a DNA-binding protein, but this can vary depending on the steric access to the DNA by the tethered MNase. Single-end sequencing is not recommended for CUT&RUN, as it sacrifices resolution and discrimination between transcription factors and neighboring nucleosomes.
Scripts are available from https://github.com/Henikoff/Cut-and-Run for spike-in calibration and for peak-calling.