Oct 03, 2020
CRISPRon-GFP (based on pX459 plasmid) cloning of guides
This protocol is a draft, published without a DOI.
- 1Shahar Taiber
- AhituvLab
Protocol Citation: Ofer Barnea-Yizhar 2020. CRISPRon-GFP (based on pX459 plasmid) cloning of guides. protocols.io https://protocols.io/view/crispron-gfp-based-on-px459-plasmid-cloning-of-gui-bmmuk46w
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 23, 2020
Last Modified: October 03, 2020
Protocol Integer ID: 42388
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
This protocol was written in accordance in accordance with the Zheng Lab protocol and the following lessons learned from the following papers.
Materials
MATERIALS
QIAprep Spin Miniprep KitQiagenCatalog #27104
BbsI-HF - 1,500 unitsNew England BiolabsCatalog #R3539L
pSpCas9(BB)-2A-Puro (PX459) V2.0addgeneCatalog #62988
10 U/μl NEB T4 PNK, 3 U/μl NEB T4 DNA polymerase I , 5 U/μl NEB DNA polymerase I, Large (Klenow) FragmentNew England Biolabs
STEP MATERIALS
NEB 5-alpha Competent E.coli (High Efficiency) - 20x0.05 mlNew England BiolabsCatalog #C2987H
SOC Outgrowth Medium - 100 mlNew England BiolabsCatalog #B9020S
SOC Outgrowth Medium - 100 mlNew England BiolabsCatalog #B9020S
QIAprep Spin Miniprep KitQiagenCatalog #27104
BbsINew England BiolabsCatalog #R0539S
Protocol materials
SOC Outgrowth Medium - 100 mlNew England BiolabsCatalog #B9020S
BbsINew England BiolabsCatalog #R0539S
QIAprep Spin Miniprep KitQiagenCatalog #27104
pSpCas9(BB)-2A-Puro (PX459) V2.0addgeneCatalog #62988
SOC Outgrowth Medium - 100 mlNew England BiolabsCatalog #B9020S
QIAprep Spin Miniprep KitQiagenCatalog #27104
BbsI-HF - 1,500 unitsNew England BiolabsCatalog #R3539L
10 U/μl NEB T4 PNK, 3 U/μl NEB T4 DNA polymerase I , 5 U/μl NEB DNA polymerase I, Large (Klenow) FragmentNew England Biolabs
NEB 5-alpha Competent E.coli (High Efficiency) - 20x0.05 mlNew England BiolabsCatalog #C2987H
BbsINew England BiolabsCatalog #R0539S
NEB 5-alpha Competent E.coli (High Efficiency) - 20x0.05 mlNew England BiolabsCatalog #C2987H
SOC Outgrowth Medium - 100 mlNew England BiolabsCatalog #B9020S
SOC Outgrowth Medium - 100 mlNew England BiolabsCatalog #B9020S
QIAprep Spin Miniprep KitQiagenCatalog #27104
Vector digest
Vector digest
Digest 1 µg of an empty vector with
BbsINew England BiolabsCatalog #R0539S
(the enzyme is kept in -80 REVCO). Comprise the reaction as follows:
| Vector (dervided from CRIPSRon) | 1-1.5 ug ( X uL) | |
| BbsI enzyme | 1 uL | |
| NEB buffer 2.1 | 5 uL | |
| ddH2O | up to 50 uL | |
| TOTAL | 50 uL |
Run for 1hr at37 °C , and another 00:20:00 at 65 °C for inactivation
OPTIONAL - run a sample from the digested product on 1% agarose gel with an UNCUT control
Phosphorylate and anneal each pair of oligosVector digest
Phosphorylate and anneal each pair of oligosVector digest
In a 0.2ml PCR tube prepare the annealing and phosphorylation reaction as follows:
| FWD oligo (100uM) | 1 uL | |
| REV oligo (100uM) | 1 uL | |
| 10X T4 ligation buffer (NEB) | 1 uL | |
| T4 PNK (NEB) | 0.5 uL | |
| ddH2O | 6.5 uL | |
| TOTAL | 10 uL |
Run the reaction in a thermocycler according to the following parameters
37 °C 20min
95 °C 5min
then ramp down to 25oC at the rate of 5oC per min
[see program OFER/CRISPRAN in the thermocycler ]
Ligation reaction
Ligation reaction
In a 0.2ml PCR tube prepare the ligation reaction as follows:
[no need to check the concentration of the gel purified digested vector, just take a fix volume]
| BbsI digested vector from previous step | 5 uL | |
| Phosphorylated and annealed oligo duplex from previous step (1:250 dilution) | 1 uL | |
| 10X T4 ligation buffer (NEB) | 2 uL | |
| ddH2O | 11 uL | |
| T4 Ligase (NEB) | 1 uL |
It is possible to prepare a stock of the T4 Ligase, buffer water and digested plasmid and aliquot 19ul to each 0.2ml PCR tube.
Put the reaction in a thermocycler set at 25 °C for 10-15min
Transformation
Transformation
Thaw a tube of NEB 5-alpha Competent E. coli cells on ice for 10 minutes.
00:10:00
Note
Cells are best thawed on ice and DNA added as soon as the last bit of ice in the tube disappears. Cells can also be thawed by hand, but warming above 0°C will decrease the transformation efficiency.
NEB 5-alpha Competent E.coli (High Efficiency) - 20x0.05 mlNew England BiolabsCatalog #C2987H
Add 1-5 µl containing 1 pg-100 ng of plasmid DNA to the cell mixture.
Carefully flick the tube 4-5 times to mix cells and DNA. Do not vortex.
Place the mixture on ice for 30 minutes. Do not mix.
00:30:00
Note
For maximum transformation efficiency, cells and DNA should be incubated together on ice for 30 minutes. Expect a 2-fold loss in transformation efficiency for every 10 minutes this step is shortened.
Heat shock at exactly 42°C for exactly 30 seconds. Do not mix.
00:00:30
Note
Both the temperature and the timing of the heat shock step are important and specific to the transformation volume and vessel. Using the transformation tube provided, 30 seconds at 42°C is optimal.
Place on ice for 5 minutes. Do not mix.
00:05:00
Pipette 950 µl of room temperature SOC into the mixture.
950 µL
SOC Outgrowth Medium - 100 mlNew England BiolabsCatalog #B9020S
Place at 37°C for 60 minutes., shaking vigorously (250 rpm) or rotating.
01:00:00
Note
Outgrowth at 37°C for 1 hour is best for cell recovery and for expression of antibiotic resistance. Expect a 2-fold loss in transformation efficiency for every 15 minutes this step is shortened. SOC gives 2-fold higher transformation efficiency than LB medium; and incubation with shaking or rotating the tube gives 2-fold higher transformation efficiency than incubation without shaking.
Warm selection plates to 37°C. (Ampicilin)
Note
Selection plates can be used warm or cold, wet or dry without significantly affecting the transformation efficiency. However, warm, dry plates are easier to spread and allow for the most rapid colony formation.
Mix the cells thoroughly by flicking the tube and inverting.
SOC Outgrowth Medium - 100 mlNew England BiolabsCatalog #B9020S
Perform several 10-fold serial dilutions in SOC.
Spread 50-100 µl of each dilution onto a selection plate
Incubate overnight at 37°C
15:00:00
Note
Alternatively, incubate at 30°C for 24-36 hours or 25°C for 48 hours.
Sequence analysis
Sequence analysis
Pick up to 4 colonies for each sgRNA clone (oligo pair) and touch a REPLICA plate and insert into 2ml liquid LB (in a 2phase 13ml tube) with the right selectable marker antibiotic (ampicillin or kanamycin)
grow 2 colonies per gRNA, keep 4 on replica plates. Do not throw away the transformation plates until a positive clone is confirmed
Grow in arotating incubator for 6-18hrs (until the media opaque)
grow 2 colonies per gRNA, keep 4 on replica plates. Do not throw away the transformation plates until a positive clone is confirmed
Use plasmid miniprep kit
QIAprep Spin Miniprep KitQiagenCatalog #27104
Send to sequencing using either the px459-U6-SEQ primer or the pLKO5.1 primer
pLKO5.1 SEQ primer gactatcatatgcttaccgt
px459-U6-SEQ primer caaggctgttagagagataa