Nov 12, 2023

CRISPR nuclease (CRISPRn) genome editing V.1

  • 1University of California, San Diego
Icon indicating open access to content
QR code linking to this content
Protocol CitationLeonardo Parra-Rivas 2023. CRISPR nuclease (CRISPRn) genome editing. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gp35qpvzp/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 12, 2023
Last Modified: November 12, 2023
Protocol  Integer ID: 90813
Keywords: editing crispr nuclease, crispr nuclease, crispr, crisprn, genome
Abstract
CRISPR nuclease (CRISPRn) genome editing
LentiCRISPRv2 plasmid (RRID:Addgene_52961) was used for α-syn genome editing. All sgRNAs were designed using CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) and examined for genome-wide sequence specificityusing the National Center for Biotechnology Information’s (NCBI) Basic Local Alignment Search Tool NCBI BLAST (RRID:SCR_004870)( http://blast.ncbi.nlm.nih.gov/Blast.cgi). The sgRNAs (Control 5’ GACGGAGGCTAAGCGTCGCAA3’ and α-syn CRISPRn 5’ GGTTCATGAAAGGACTTTCAA3’) were cloned as described previously
Citation
Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S., Heckl, D., Ebert, B.L., Root, D.E., Doench, J.G., and Zhang, F. (2014). (2013). Genome-scale CRISPR-Cas9 knockout screening in human cells. Science.
LINK

To validate the sgRNAs constructs, DIV-3 hippocampal primary neurons were infected with lentiviruses per 6hrs (MOI=5). Transduced neurons were cultured to maturity (DIV17-DIV21) and then lysate for western blotting analysis and genomic analysis. 
Citations
Step  1
Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S., Heckl, D., Ebert, B.L., Root, D.E., Doench, J.G., and Zhang, F. (2014).. Genome-scale CRISPR-Cas9 knockout screening in human cells
10.1126/science.1247005