Nov 12, 2023

Public workspaceCRISPR knock-in validation V.1

  • 1University of California, San Diego
Icon indicating open access to content
QR code linking to this content
Protocol CitationLeonardo A Parra-Rivas 2023. CRISPR knock-in validation. protocols.io https://dx.doi.org/10.17504/protocols.io.n2bvj3qb5lk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 12, 2023
Last Modified: November 12, 2023
Protocol Integer ID: 90815
Abstract
CRISPR knock-in validation
Cultured hippocampal neurons tagged with oScarlet were prepared with Lucigen QuickExtract DNA extraction solution (Biosearch Technologies, cat# QE09050). Briefly, neurons were lysed by adding 50 ul of QuickExtract solution to each sample.
The samples were mixed by pipetting and incubated at 68 °C for 15 min followed by 95 °C for 10 min in a thermocycler before being stored at -20 °C for downstream analysis.
Two different PCR reactions were performed to amplify DNA products of ~500 bp corresponding to the 5’ and 3’ integration junctions. PCR#1 used the α-syn forward primer: TGTGCTTTCTCTTCCCTCTCTG and the reverse oScarlet primer CCGTCCTCGAAGTTCATCAC, whereas PCR#2 used the α-syn forward primer: ATAACACTTCGTGCAGCACC and the reverse oScarlet primer ACAGGATGTCCCAGGAGAAG.
PCR products were extracted from the agarose gel using the Monarch DNA gel extraction kit (New England Biolabs, cat# T1020S), and samples were submitted for sequencing for analysis at MCLAB.