Mar 15, 2024

CRISPR inhibition (CRISPRi) of LINC01876 in hiPSCs and fbNPCs

  • 1Laboratory of Molecular Neurogenetics, Department of Experimental Medical Science, Wallenberg Neuroscience Center and Lund Stem Cell Center, BMC A11, Lund University, 221 84 Lund, Sweden.
Icon indicating open access to content
QR code linking to this content
Protocol Citationanita.adami 2024. CRISPR inhibition (CRISPRi) of LINC01876 in hiPSCs and fbNPCs. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlkwnq6l5r/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 07, 2023
Last Modified: May 31, 2024
Protocol  Integer ID: 76525
Keywords: ASAPCRN, crispr inhibition, crispr, crispri in hipsc, linc01876 in hipsc, crispri, hipsc, linc01876
Funders Acknowledgements:
Aligning Science Across Parkinson’s through the Michael J. Fox Foundation for Parkinson’s Research
Grant ID: ASAP-000520
Swedish Research Council
Grant ID: 2018-02694
Swedish Brain Foundation
Grant ID: FO2019-0098
Cancerfonden
Grant ID: 190326
Barncancerfonden
Grant ID: PR2017-0053
NIHR Cambridge Biomedical Research Centre
Grant ID: NIHR203312
Swedish Society for Medical Research
Grant ID: S19-0100
National Institutes of Health
Grant ID: HG002385
Swedish Research Council
Grant ID: 2021-03494
Swedish Research Council
Grant ID: 2020-01660
Abstract
This protocol describes how to perform CRISPRi in hiPSCs and fbNPCs
gRNA design
To design the silencing of the expression of LINC01876 in hiPSCs, the protocol detailed in Johansson et al., 2022 was adapted.

Single guide sequences were designed to recognise DNA regions near the transcription start site (TSS) of the chosen locus according to the GPP Portal (Broad Institute).
CRISPR gRNA cloning and virus production
1h 30m
The guide sequences were cloned into a deadCas9-KRAB-T2A-GFP lentiviral backbone, pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP, a gift from Charles Gersbach (Addgene plasmid #71237 RRID:Addgene_71237), using annealed oligos and the BsmBI cloning site.

To see the detailed protocol for the gRNA cloning, see CRISPR gRNAs cloning protocol.
Lentiviral vectors were produced from the plasmids according to the protocol published by Zufferey et al., 1997.

Briefly, HEK293T cells were grown to a confluency of 70 – 90% for lentiviral production. Third-generation packaging and envelope vectors (pMDL, psRev, and pMD2G) together with Polyethyleneimine (PEI Polysciences PN 23966, in DPBS (GIBCO) were used in conjunction with the lentiviral plasmids previously generated.
The lentivirus was harvested 2 days after transfection. The media was collected, filtered and centrifuged at 25000 x g, 4°C for 01:30:00 . The supernatant was removed from the tubes and the virus was resuspended in PBS and left at4 °C . The resulting lentivirus was aliquoted and stored at 80 °C .
1h 30m
CRISPRi in iPSCs
The iPSCs were then transduced with MOI 10 of LacZ control and two LINC1876-targeting gRNAs, which led to three separate conditions:

  1. LacZ control-,
  2. LINC1876 g1-,
  3. and LINC1876 g2- transduced cells.
The gRNAs efficiency was validated using standard quantitative real-time RT-PCR.

Briefly, total RNA was first extracted using the miniRNeasy kit (QIAGEN), and cDNA was generated using the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific). Quantitative qPCR was performed using SYBR Green I master (Roche) on a LightCycler 480 (Roche). The 2-ΔΔCt method was used to normalise expression to control, relative to housekeeping genes GAPDH and B-ACTIN expression.


Note
Gene Primer sequences (5’ to 3’):

  • LINC01876 Fw AATCCGTGCCAGCAGTAAGT Rev GGACCTCTTCAAGTCCCAGG
  • ACTB Fw CCTTGCACA TGCCGGAG Rev GCACAGAGCCTCGCCTT
  • GAPDH Fw TTGAGGTCAARGAAGGGGTC Rev GAAGGTGAAGGTCGGAGTCA

To select the successfully transduced cells expressing the vector we leveraged the GFP gene expressed by the employed vector as follows.

7 days post transduction, cells were detached with Accutase (75 ml/cm2; GIBCO), resuspended in iPS media (StemMACS iPS-Brew XF and 0.5% penicillin/streptomycin (GIBCO)) containing RY27632 (10 μM) and Draq7 (1:1000) and strained with a 70μm filter. Gating parameters were determined by side and forward scatter to eliminate debris and aggregated cells. The GFP-positive gates were set using untransduced iPSCs. The sorting gates and strategies were validated via reanalysis of sorted cells (> 95% purity cut-off). 200.000 GFP-positive/Draq7-negative cells were collected per sample, spun down at 400g for 5 min and resuspended in iPS media containing RY27632 (10 μM) and either expanded or frozen down for further use.
CRISPRi in neural progenitor cells (NPCs)
The selected iPSCs were the differentiated into NPCs according to the differentiation protocol described in Forebrain neural progenitor cells differentiation from iPSCs.
NPCs that were efficiently expressing the vector of interest were selected as follows.

At day 14 cells were detached with Accutase (75 ml/cm2; GIBCO), resuspended in B27 media (Neurobasal supplemented with 1% B27 without vitamin A (GIBCO), 2 mM L-glutamine and 0.2% penicillin/streptomycin Y27632 (10 μM), BDNF (20 ng/ml; R&D), and L-ascorbic acid (0.2 mM; Sigma) containing RY27632 (10 μM) and Draq7 (1:1000, BD Bioscience) and strained with a 70μm (BD Bioscience) filter. Gating parameters were determined by side and forward scatter to eliminate debris and aggregated cells. The GFP-positive gates were set using untransduced fbNPCs. The sorting gates and strategies were validated via reanalysis of sorted cells (> 95% purity cut-off). 200.000 GFP-positive/Draq7-negative cells were collected per sample, spun down at 400g for 5 min and snap frozen on dry ice. Cell pellets were kept at −80°C until RNA was isolated.